ID: 1115502239

View in Genome Browser
Species Human (GRCh38)
Location 14:34060221-34060243
Sequence AGGTAGTCGGTAACTGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502231_1115502239 -8 Left 1115502231 14:34060206-34060228 CCGCGGCCGCCCCGAAGGTAGTC 0: 1
1: 0
2: 0
3: 6
4: 33
Right 1115502239 14:34060221-34060243 AGGTAGTCGGTAACTGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1115502228_1115502239 -1 Left 1115502228 14:34060199-34060221 CCTGCGCCCGCGGCCGCCCCGAA 0: 1
1: 0
2: 1
3: 38
4: 303
Right 1115502239 14:34060221-34060243 AGGTAGTCGGTAACTGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1115502224_1115502239 30 Left 1115502224 14:34060168-34060190 CCGCGGCGGACACCGAGCCACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1115502239 14:34060221-34060243 AGGTAGTCGGTAACTGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1115502230_1115502239 -7 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502239 14:34060221-34060243 AGGTAGTCGGTAACTGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1115502225_1115502239 18 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502239 14:34060221-34060243 AGGTAGTCGGTAACTGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1115502226_1115502239 13 Left 1115502226 14:34060185-34060207 CCACACGCACTGTGCCTGCGCCC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1115502239 14:34060221-34060243 AGGTAGTCGGTAACTGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115502239 Original CRISPR AGGTAGTCGGTAACTGCGGC GGG Intronic