ID: 1115502241

View in Genome Browser
Species Human (GRCh38)
Location 14:34060227-34060249
Sequence TCGGTAACTGCGGCGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 48}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502233_1115502241 -8 Left 1115502233 14:34060212-34060234 CCGCCCCGAAGGTAGTCGGTAAC 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1115502241 14:34060227-34060249 TCGGTAACTGCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 48
1115502228_1115502241 5 Left 1115502228 14:34060199-34060221 CCTGCGCCCGCGGCCGCCCCGAA 0: 1
1: 0
2: 1
3: 38
4: 303
Right 1115502241 14:34060227-34060249 TCGGTAACTGCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 48
1115502226_1115502241 19 Left 1115502226 14:34060185-34060207 CCACACGCACTGTGCCTGCGCCC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1115502241 14:34060227-34060249 TCGGTAACTGCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 48
1115502225_1115502241 24 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502241 14:34060227-34060249 TCGGTAACTGCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 48
1115502230_1115502241 -1 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502241 14:34060227-34060249 TCGGTAACTGCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 48
1115502231_1115502241 -2 Left 1115502231 14:34060206-34060228 CCGCGGCCGCCCCGAAGGTAGTC 0: 1
1: 0
2: 0
3: 6
4: 33
Right 1115502241 14:34060227-34060249 TCGGTAACTGCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115502241 Original CRISPR TCGGTAACTGCGGCGGGCGG CGG Intronic