ID: 1115502244

View in Genome Browser
Species Human (GRCh38)
Location 14:34060233-34060255
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 368}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502228_1115502244 11 Left 1115502228 14:34060199-34060221 CCTGCGCCCGCGGCCGCCCCGAA 0: 1
1: 0
2: 1
3: 38
4: 303
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502225_1115502244 30 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502235_1115502244 -6 Left 1115502235 14:34060216-34060238 CCCGAAGGTAGTCGGTAACTGCG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502236_1115502244 -7 Left 1115502236 14:34060217-34060239 CCGAAGGTAGTCGGTAACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502233_1115502244 -2 Left 1115502233 14:34060212-34060234 CCGCCCCGAAGGTAGTCGGTAAC 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502231_1115502244 4 Left 1115502231 14:34060206-34060228 CCGCGGCCGCCCCGAAGGTAGTC 0: 1
1: 0
2: 0
3: 6
4: 33
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502226_1115502244 25 Left 1115502226 14:34060185-34060207 CCACACGCACTGTGCCTGCGCCC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502230_1115502244 5 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502234_1115502244 -5 Left 1115502234 14:34060215-34060237 CCCCGAAGGTAGTCGGTAACTGC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type