ID: 1115503325

View in Genome Browser
Species Human (GRCh38)
Location 14:34068520-34068542
Sequence TTGTTTATGAATAAGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 545}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115503325_1115503328 12 Left 1115503325 14:34068520-34068542 CCCACTTTCTTATTCATAAACAA 0: 1
1: 0
2: 4
3: 40
4: 545
Right 1115503328 14:34068555-34068577 TTTGGCATGAAGTATCTCTCTGG 0: 1
1: 0
2: 2
3: 23
4: 181
1115503325_1115503327 -6 Left 1115503325 14:34068520-34068542 CCCACTTTCTTATTCATAAACAA 0: 1
1: 0
2: 4
3: 40
4: 545
Right 1115503327 14:34068537-34068559 AAACAACTGTCTTTTTGCTTTGG 0: 1
1: 0
2: 2
3: 37
4: 320
1115503325_1115503329 16 Left 1115503325 14:34068520-34068542 CCCACTTTCTTATTCATAAACAA 0: 1
1: 0
2: 4
3: 40
4: 545
Right 1115503329 14:34068559-34068581 GCATGAAGTATCTCTCTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115503325 Original CRISPR TTGTTTATGAATAAGAAAGT GGG (reversed) Intronic
901564817 1:10105204-10105226 AAGTTTATTAAAAAGAAAGTTGG - Intronic
902068872 1:13714558-13714580 TTGTTTTTTAATAAGGTAGTTGG - Intronic
903025803 1:20429250-20429272 ATGTTTCTGAACAGGAAAGTGGG - Intergenic
903546615 1:24127975-24127997 TTGTTTATCCATAAAAGAGTTGG - Intronic
904099605 1:28013368-28013390 ATAATTATGAATAAGAAAGAGGG - Intronic
904869881 1:33610038-33610060 CTGTCTATGAACTAGAAAGTGGG + Intronic
905123463 1:35700469-35700491 TTGTTTAAAAATAAGACAGGAGG - Intergenic
905937791 1:41838574-41838596 TTCTTGATGAATTAGAAAGCAGG - Intronic
906275016 1:44508901-44508923 TTTTTTATGATGAAGAAACTGGG + Intronic
906555823 1:46712671-46712693 TTGTTTTTCAAGAAGACAGTGGG - Intronic
907217946 1:52882191-52882213 TTATTTAGAAATAAGGAAGTTGG - Intronic
907905493 1:58781428-58781450 TTGTTTGTAAATAAGAGATTTGG - Exonic
908190261 1:61696236-61696258 TTGTTTATAAAAAAGAATATTGG + Intronic
908901107 1:68957573-68957595 CTGTCTATGAACAAGGAAGTAGG + Intergenic
909239387 1:73192806-73192828 TTGTTTATGAACCAGCAAGAAGG - Intergenic
909824306 1:80108061-80108083 TTGTTTATAAAAAAGAGATTTGG - Intergenic
910127212 1:83856042-83856064 TTTTTTATGAAAAAAAAAGGTGG + Intergenic
911366898 1:96949510-96949532 CTGTCTATGAATCAGGAAGTGGG - Intergenic
911445431 1:97986127-97986149 TAGTTTAGGAATAAGAAACTTGG + Intergenic
911448767 1:98036428-98036450 TTGTTTATAATTAATAAAATAGG + Intergenic
911633350 1:100207093-100207115 TTTTTTATTGATAAGAATGTAGG + Intronic
911989876 1:104681466-104681488 TAATTAATGAATAAGAAAGTAGG + Intergenic
912063497 1:105704995-105705017 TTCTATAAAAATAAGAAAGTAGG - Intergenic
913031152 1:114904030-114904052 TTGAAAATGAATAATAAAGTTGG - Intronic
914019856 1:143856656-143856678 ATGTGTATGAATGAGCAAGTAGG + Intergenic
915715988 1:157945679-157945701 TTGTCTATGAACCAGAAAGCAGG + Intergenic
916032131 1:160886503-160886525 TTGTTTGTAAATATGAAAGCTGG - Intergenic
916393755 1:164362455-164362477 TTGCCTATGAATAAAAATGTCGG + Intergenic
917200835 1:172513393-172513415 TTGTTTATGAAATATAAAATTGG - Intergenic
917201616 1:172522833-172522855 CTGTCTATGCATGAGAAAGTGGG + Intergenic
917718993 1:177768081-177768103 TTGCTTAGGAGTAAGATAGTGGG - Intergenic
917923436 1:179769801-179769823 CTGTTTATAAGTAAGAAAGCTGG - Intronic
917934823 1:179855771-179855793 ATGTTCATTAATAAGAAAGTGGG + Intronic
918211204 1:182352756-182352778 TTGATTATTAATATGGAAGTTGG + Intergenic
919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG + Intronic
920160123 1:203991123-203991145 CTGCTTATGTATGAGAAAGTCGG + Intergenic
922432929 1:225573832-225573854 ATGTTTCTGAATAAGTGAGTTGG - Intronic
922444722 1:225687510-225687532 TTGTTTAAAAAAAAAAAAGTTGG + Intergenic
922988278 1:229883729-229883751 GTGCTTATGAAAAAGAAAGCAGG - Intergenic
923142014 1:231168524-231168546 TTGTTATTAAAAAAGAAAGTAGG - Intronic
923197734 1:231684500-231684522 TTGTTTGAGAATAATACAGTAGG + Intronic
923852403 1:237811520-237811542 TTTTTTATTAAAAAGAAAGTTGG - Intronic
924152911 1:241146839-241146861 TCATCTATGAATCAGAAAGTGGG - Intronic
924221871 1:241885516-241885538 TTGTTTCAGAATAAGAAACAAGG - Intronic
924261510 1:242236147-242236169 CTGTCTATGAACAAGGAAGTGGG + Intronic
924408700 1:243780182-243780204 TTTATAATGAAGAAGAAAGTTGG + Intronic
1064885615 10:20108850-20108872 TTGTAGGTGAATAAGAATGTAGG + Intronic
1065426572 10:25611229-25611251 TTGTTTATGGATAATATATTTGG - Intergenic
1067140522 10:43652651-43652673 TTGTTTATAAGCCAGAAAGTGGG + Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1068026268 10:51649196-51649218 CTGGTTTTGAAAAAGAAAGTAGG - Intronic
1068419404 10:56770766-56770788 TTGCTGTTGAATGAGAAAGTGGG - Intergenic
1068740808 10:60467829-60467851 CTGTTTATGAATACATAAGTTGG + Intronic
1069178106 10:65320228-65320250 ATGTAAATGAATAAGAAAGGAGG + Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069281454 10:66659745-66659767 TTATCTATGAACCAGAAAGTGGG + Intronic
1069317094 10:67119031-67119053 CTGTTTGGGACTAAGAAAGTAGG + Intronic
1069652290 10:70058483-70058505 TTGTTTCTGGATATGAAAGGCGG + Intronic
1069862061 10:71477747-71477769 TGGTTTAAGAACAAGAAAGTTGG - Intronic
1070653020 10:78251874-78251896 ACGTCTATGAATAAGGAAGTGGG - Intergenic
1070759898 10:79017573-79017595 TTGTATATGACTAAGAATATTGG - Intergenic
1071760178 10:88594432-88594454 TTGTATATGAAAAATAGAGTAGG - Intronic
1072411379 10:95205389-95205411 CTATTTCTGAATCAGAAAGTGGG - Intronic
1073233878 10:101996684-101996706 GTGTTTATGAATACAAAACTAGG + Intronic
1073786176 10:106892277-106892299 TTGTTTACGAATAAGACAAGTGG - Intronic
1074120749 10:110493089-110493111 TTGTTTTTAATTATGAAAGTAGG - Intergenic
1074171517 10:110943765-110943787 TTGTTTAGATATAAGAAAATAGG - Intronic
1074399757 10:113132374-113132396 TTGTAAATAAATTAGAAAGTTGG + Intronic
1075701416 10:124472008-124472030 GTTTTTATGAATAACAATGTTGG + Intronic
1076330576 10:129662097-129662119 TTGTTTGTAAATAAGAATGGGGG + Intronic
1077849691 11:6063477-6063499 TTGTTTAAGATGAAGAAAGGGGG - Intergenic
1077989828 11:7395508-7395530 TTGTTTATGAATCCCAATGTGGG + Intronic
1078151490 11:8763141-8763163 TTGTTGATGACTAATAAAGTTGG - Intronic
1079042481 11:17071833-17071855 TTACTTAGAAATAAGAAAGTGGG + Intergenic
1079227113 11:18616278-18616300 TTCTATATGACTAAGCAAGTGGG + Intronic
1079900370 11:26175558-26175580 ATGTTTATGAGTAAAGAAGTAGG + Intergenic
1079902724 11:26208027-26208049 TCATCTATGAATAAGAAAATGGG - Intergenic
1079973722 11:27066916-27066938 TTATTAATCAATAAGAAAGTAGG + Intronic
1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG + Intronic
1082717394 11:56631082-56631104 TTGTTAATGAAAAAAACAGTGGG + Intergenic
1082856148 11:57808662-57808684 TAGTTTATGAATGCGAGAGTTGG + Intronic
1083007986 11:59366978-59367000 TTGTATATTAATAAGCAATTTGG - Intergenic
1083117618 11:60478089-60478111 TTGTGTATGTCTAAGAAAGTAGG - Intergenic
1083194388 11:61075340-61075362 TTGTTGATGAATGATAAAGAAGG + Intergenic
1083248293 11:61447324-61447346 TATTTTATACATAAGAAAGTGGG + Exonic
1085096406 11:73763971-73763993 TTGTCTATGAACCAGGAAGTGGG - Intergenic
1085551502 11:77377613-77377635 TTGTTCATGAATACTTAAGTAGG + Intronic
1085578783 11:77631683-77631705 TTTTTTTTTAATAAGAATGTTGG - Intronic
1085588448 11:77733861-77733883 TTGTTTAGGAATGAAAAAGATGG - Intronic
1086754350 11:90540848-90540870 TTGTTTTTAAATAAATAAGTTGG - Intergenic
1087033580 11:93731977-93731999 ATGTTTATGAGTAAAAATGTAGG - Intronic
1087570438 11:99920664-99920686 TTGTCTATGGACCAGAAAGTGGG - Intronic
1087741654 11:101894740-101894762 TAGATTAGGAATAAGAAAGCTGG - Intronic
1088299936 11:108346642-108346664 TAGTTTATAAACAAGAAAGTAGG + Intronic
1089571227 11:119411725-119411747 CTGTCTATAAATCAGAAAGTGGG - Intergenic
1089581410 11:119483868-119483890 TTGTCCATGAATAAAAAAGCGGG - Intergenic
1090135065 11:124189205-124189227 TTGTTTCTTATTAAGAAAGGAGG - Intergenic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1091029350 11:132170669-132170691 TTCTTTATAAATGAGAAAGCTGG - Intronic
1091517818 12:1202701-1202723 TGATTCATGAATAATAAAGTAGG + Intronic
1091990683 12:4953313-4953335 GTGTTAATGAAAAAGAAAGGAGG + Intergenic
1092181479 12:6449967-6449989 TTGTTATTAAAGAAGAAAGTTGG - Intronic
1092693452 12:11142394-11142416 TTGTTAAAAAATAAGAAATTTGG + Intronic
1092769197 12:11881516-11881538 CTGTCTATGAACCAGAAAGTGGG - Intronic
1092808186 12:12246942-12246964 TTGTTTTTGACTAAGAAAGTTGG - Intronic
1092915308 12:13184075-13184097 TTGTTTATGTCTATCAAAGTAGG + Intergenic
1093134473 12:15433934-15433956 TTGTTTTTGAAACAGAATGTTGG + Intronic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093521552 12:20057163-20057185 TTTTTGATGAGTAATAAAGTTGG + Intergenic
1093540806 12:20282455-20282477 TTGCAAATGAATAAGAAAGTAGG + Intergenic
1094009616 12:25793513-25793535 TTGTTCATGCACAAGAAACTAGG - Intergenic
1094436305 12:30424338-30424360 TTGCTGTTGAATAGGAAAGTAGG + Intergenic
1094589017 12:31803725-31803747 TTATTTATGACTATGCAAGTGGG - Intergenic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1095565358 12:43616844-43616866 TTTTTTTTTAAGAAGAAAGTTGG - Intergenic
1097879909 12:64677378-64677400 TTGTTTTAAAATAATAAAGTAGG - Intronic
1098435379 12:70463353-70463375 TTGCTTTTGAATGGGAAAGTGGG - Intergenic
1098726615 12:73976581-73976603 ATGTTTGTGAAAAAAAAAGTAGG - Intergenic
1098854975 12:75642346-75642368 TTGTTCCTCAATTAGAAAGTTGG - Intergenic
1099156908 12:79188904-79188926 TTTTATAAGAATAATAAAGTGGG - Intronic
1099456923 12:82874736-82874758 TTTGTTAAGAATTAGAAAGTGGG - Intronic
1099832649 12:87865043-87865065 TTGTTTCTGAGGAAGAAAGGAGG - Intergenic
1100527425 12:95432757-95432779 TTGTTTTTTAAAAAGAAATTGGG + Intergenic
1101007042 12:100411151-100411173 TTGTTTAGGAGTAAAAAAATAGG + Intronic
1101888850 12:108693204-108693226 TTGTTTGTGAATTAGAACTTAGG - Intronic
1103749194 12:123147928-123147950 TTGATAATGAAAAGGAAAGTGGG - Intronic
1104116608 12:125755043-125755065 TAGTTTATGAAGAAGAACATAGG - Intergenic
1104177190 12:126344226-126344248 TAGCTTAGGAATGAGAAAGTGGG - Intergenic
1104197879 12:126558517-126558539 TTGTTTATAAATGAGAAAACTGG - Intergenic
1104235645 12:126933965-126933987 TTGTTTTTGGGTAAGAAATTGGG - Intergenic
1104611946 12:130236066-130236088 TGTTTAATGAATAATAAAGTCGG - Intergenic
1105582894 13:21717722-21717744 TGTTTTATGAATAACAAACTAGG + Intergenic
1106951293 13:34887030-34887052 TACTTTATAAATAAGAAACTTGG + Intergenic
1107687397 13:42917155-42917177 GTGATAATGCATAAGAAAGTAGG - Intronic
1108006852 13:45956740-45956762 TTGTTTTTGAATAAAATTGTTGG + Intronic
1108119372 13:47166725-47166747 TTGTTTATAAATAGAATAGTGGG + Intergenic
1108452846 13:50584867-50584889 TTGTTCATGGATAAGTAAATTGG - Intronic
1109231548 13:59763874-59763896 TTTTGTGTGAATAAGTAAGTTGG + Intronic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109819393 13:67633231-67633253 TAGTTTTTGAATCAGGAAGTGGG + Intergenic
1110242964 13:73289040-73289062 TTATCTTTCAATAAGAAAGTTGG + Intergenic
1110569461 13:76989132-76989154 TTCTTAGTGAATAAGAAAGCAGG - Intergenic
1110877872 13:80532849-80532871 TTCTTCATGAAAAAGAAATTAGG + Intergenic
1111020781 13:82447065-82447087 TATTTTATGGAGAAGAAAGTAGG + Intergenic
1111458201 13:88510388-88510410 TTGTCTGTGAATAAAAAAGAGGG + Intergenic
1111652234 13:91106057-91106079 TTCTTTATGAAAAAGAAAAATGG + Intergenic
1111829833 13:93313891-93313913 TTGTTTATGAAATAGCCAGTTGG - Intronic
1111870362 13:93824584-93824606 TTGTTTAAAAAAAAAAAAGTTGG - Intronic
1111883320 13:93986088-93986110 TTGTTTTTGAAAATGAAACTTGG - Intronic
1111900870 13:94198330-94198352 CTTTTTATGAATAAGTAACTTGG + Intronic
1112005659 13:95251553-95251575 TTGTTTATTTCTAATAAAGTTGG - Intronic
1112925631 13:104671155-104671177 GTGATTATGAATAAGAAAAATGG - Intergenic
1113102921 13:106739796-106739818 TTTTTTAAGAAGAAGAAAGGGGG + Intergenic
1114280065 14:21185565-21185587 TTTTCTATGAATCAGAAATTTGG + Intergenic
1114467522 14:22933955-22933977 TTGATTGTGAAAAAGAAATTTGG - Intergenic
1115101034 14:29700261-29700283 TTGTTTATGGAGTAGAAATTAGG - Intronic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1116339832 14:43707863-43707885 ATGCTTATGAAAAAGAAATTGGG + Intergenic
1116552056 14:46253488-46253510 TTGATTATAAAGAAGAAAATGGG + Intergenic
1116788581 14:49315085-49315107 TAGTTTATCAAAATGAAAGTTGG + Intergenic
1116965093 14:51005995-51006017 TTGTTGATAAAAAAGAAAGTAGG - Intronic
1117101008 14:52347537-52347559 TTTCTTATGGATAAGAAAGGTGG + Intergenic
1117303629 14:54452017-54452039 TTATTTATAAATCAGAAATTGGG - Intergenic
1117392728 14:55277768-55277790 CAGTTTATGAATAAAAATGTAGG - Intronic
1117724750 14:58661657-58661679 TTGTTTATAAATCTGAAATTCGG - Intergenic
1117885989 14:60363686-60363708 TTGTTCATGAATCTGCAAGTTGG - Intergenic
1121240872 14:92429086-92429108 TTGTGCAGAAATAAGAAAGTGGG - Intronic
1121513476 14:94532795-94532817 TGGTTTATGAATAATTAAGGAGG + Intergenic
1121757037 14:96411842-96411864 TTCTTTCTGATTAAGAAAGCTGG - Intronic
1121825196 14:97004511-97004533 CTGTTTATGAACCAGGAAGTAGG + Intergenic
1121861114 14:97319567-97319589 TTACTTATGAATAAAGAAGTAGG - Intergenic
1122196402 14:100090154-100090176 GTTTTTTTGAATGAGAAAGTTGG + Intronic
1124055359 15:26236890-26236912 CTGTCTATGAACCAGAAAGTGGG + Intergenic
1124378628 15:29145309-29145331 TTTTTTATCAAAAAGAAAGTTGG - Intronic
1125096133 15:35854355-35854377 TAGTTTATGACTAGTAAAGTAGG - Intergenic
1126752119 15:51886915-51886937 TTGCTTAATAATAAGAAATTGGG + Intronic
1127095236 15:55506173-55506195 TTGTTTATTATTGAGAAAGAGGG - Intronic
1127352055 15:58162890-58162912 TTGATTATGAATCAGCAATTTGG - Intronic
1127759787 15:62127710-62127732 TTTATTAAGAATAGGAAAGTTGG + Intergenic
1127813698 15:62587618-62587640 TTGTTTATAATTATGAAAGGAGG - Intronic
1127899637 15:63331410-63331432 TTGTTTCTGAATAGGAAAGAAGG + Intronic
1128176571 15:65561605-65561627 TTGTTGTTGAGTAAGAAAATAGG - Intronic
1128476454 15:68001071-68001093 TTTTTTGTAAATGAGAAAGTAGG + Intergenic
1128485826 15:68086821-68086843 TTCATTATGAATAATAAACTGGG - Intronic
1128741067 15:70083899-70083921 TTGGTTGTGAATAAGATGGTAGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130138332 15:81200073-81200095 TTGTTTTAGAAAAAGGAAGTTGG - Intronic
1130445344 15:83995825-83995847 TTTTTTAAGAATAACAAGGTGGG + Intronic
1130539100 15:84809150-84809172 TGGTATCTGAACAAGAAAGTAGG + Intergenic
1131581556 15:93648271-93648293 TTGTTGGTGAATAACAATGTGGG + Intergenic
1134369621 16:13610912-13610934 GTGTTTATGAATATGAAGATAGG - Intergenic
1134750587 16:16621772-16621794 TTGTTGTTGAATGGGAAAGTGGG + Intergenic
1134994867 16:18731814-18731836 TTGTTGTTGAATGGGAAAGTGGG - Intergenic
1135080939 16:19435065-19435087 TGATTTATGTATAAGAAAATTGG + Intronic
1138170950 16:54849292-54849314 TTCTCTATGAATAAGAAAAGTGG + Intergenic
1138773100 16:59688074-59688096 TTGCTTTTGGATAAGAAAGAAGG + Intergenic
1139036352 16:62951721-62951743 ATGTTAATCAATAAAAAAGTAGG + Intergenic
1142139155 16:88465015-88465037 ATGTTTTTGAAAAAGAAGGTAGG + Intronic
1144858085 17:18281770-18281792 TTGCTGCTGAATAAGAAAGGAGG - Intronic
1145854556 17:28141089-28141111 TTCTGTAAGAATTAGAAAGTGGG + Intronic
1146119767 17:30182065-30182087 TTTTTTTTAAATAAGAATGTGGG + Intronic
1146413263 17:32607712-32607734 TTGTAAATGAAGAATAAAGTTGG + Intronic
1150759822 17:67951567-67951589 TCCTTTATGTATAAAAAAGTTGG + Intronic
1150902193 17:69293014-69293036 TAATTTATTAAGAAGAAAGTAGG - Intronic
1150930860 17:69583599-69583621 TTTTTTTGGAAAAAGAAAGTAGG + Intergenic
1153526201 18:5997288-5997310 TTGTTTAGGAATAAGATGGGAGG - Intronic
1154410598 18:14139482-14139504 TTGTTAATAAATAAAAAAATTGG + Intergenic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1155866252 18:30968829-30968851 TTATTAATGAATAACAAAGAAGG - Intergenic
1156194331 18:34756762-34756784 TTCTTTATGAATAAGAAAAATGG - Intronic
1156711427 18:39951159-39951181 TTGTTTTAGAAAAAGAAAGAGGG + Intergenic
1156874815 18:41996770-41996792 TTGATCATTAATAACAAAGTTGG - Intronic
1157331570 18:46707838-46707860 CTGTTTATGAACCAGGAAGTAGG + Intronic
1157660050 18:49433575-49433597 TTAGTTATAAATAAGGAAGTAGG + Intronic
1157895077 18:51458335-51458357 TAGTTTATAAATAAGGAAATGGG + Intergenic
1158064190 18:53385912-53385934 TTGTTTAAGAATGAGTGAGTTGG - Intronic
1158705057 18:59784999-59785021 CTGTTTATTAATATGAATGTTGG + Intergenic
1159262043 18:66026730-66026752 TTTTTTATGAATATGTATGTGGG - Intergenic
1159320536 18:66841630-66841652 TGGTTTATGATTAAGCATGTGGG - Intergenic
1159403160 18:67963545-67963567 TTGTTTTTAAAGAGGAAAGTAGG - Intergenic
1159757225 18:72380637-72380659 TTGTTTAAGAATCACAAACTTGG + Intergenic
1160047068 18:75396290-75396312 TTATTTTTGAATAAAAAAGGGGG + Intergenic
1160070041 18:75620642-75620664 ATGATTAGGAATAAGAAGGTAGG + Intergenic
1161754900 19:6125441-6125463 TTGTTAATGAATAAAGAAGTTGG - Intronic
1162043345 19:7983614-7983636 TTGTTTATGGAGCAGAAAGATGG - Intronic
1162906864 19:13829288-13829310 TTGTTTAACAAAAAGAAAGAGGG + Intronic
1163911557 19:20198916-20198938 TTTTTTATGCATAGAAAAGTTGG - Exonic
1163961371 19:20696941-20696963 TTTTTTATGTATAGAAAAGTTGG - Intronic
1164331499 19:24262803-24262825 TTGTTTTTGATTAAGTAGGTTGG - Intergenic
1164375879 19:27686166-27686188 TTGGTTTTGATTAAGCAAGTTGG - Intergenic
1164728545 19:30483562-30483584 TTGTTTAAGAAGCAGAAAGAGGG - Intronic
1165298116 19:34945350-34945372 TTTTTTTTTAATAAGAATGTAGG - Intergenic
1165452512 19:35892350-35892372 TTTTTTAAAAATAAGAAAGATGG - Intronic
1166424774 19:42667952-42667974 GTGTTTATAGATAAGAAAGCAGG + Intronic
1166602205 19:44106642-44106664 TTGTTGATGAAAATCAAAGTGGG - Exonic
1167485882 19:49762788-49762810 TAGTGAATGAAGAAGAAAGTAGG - Intronic
1167817945 19:51900557-51900579 GTGTTTATAAATAAGAGAGCAGG + Intronic
925224030 2:2167075-2167097 TTCTTTATGAATAATAATGAGGG + Intronic
926335703 2:11861048-11861070 TTGTTAATGAATAAATAAATGGG + Intergenic
926599123 2:14822575-14822597 TCATTTATAAATAAGATAGTGGG - Intergenic
926933901 2:18067683-18067705 CTGTTTGTGAACCAGAAAGTGGG + Intronic
927101769 2:19793189-19793211 TTATTTATGAAACAGAAAGTTGG + Intergenic
927308908 2:21605935-21605957 TGGTTTATAAATAAGGAAATTGG + Intergenic
927577541 2:24212112-24212134 TTGCTTATCAAAAAGAAAGCTGG + Intronic
927621565 2:24666312-24666334 TTTTTTAATAATAAAAAAGTAGG - Intronic
927758650 2:25730240-25730262 TTGTAAATGAAGAACAAAGTTGG + Intergenic
928461130 2:31473684-31473706 TTGTTGATGAATAAGATACAGGG + Intergenic
928774545 2:34744269-34744291 TTGCTTATTAATCAGAAAGAAGG + Intergenic
929448088 2:42015941-42015963 CTGTCTGTGAATCAGAAAGTGGG - Intergenic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930286806 2:49440200-49440222 TTGTCTATAAAAAAGAAATTAGG + Intergenic
930542626 2:52725948-52725970 TACTTAATGAATAAGAAAGCTGG + Intergenic
930635028 2:53795074-53795096 TTGTTTATAAATAAGTCTGTAGG + Intronic
932116734 2:69057162-69057184 TTGTCTATGAATAAGAGAGCAGG - Intronic
932714535 2:74091730-74091752 GGGTTTATGAAGAAGAAAGCAGG - Intronic
933103556 2:78291141-78291163 TTGTTTACAAATAAGTAAGTTGG + Intergenic
933463486 2:82619993-82620015 TTGTTACTGAATGGGAAAGTGGG + Intergenic
933605606 2:84379217-84379239 CAGTCTATGAATCAGAAAGTGGG - Intergenic
933610455 2:84428960-84428982 TTCTTTATGAATGAGAAAACTGG - Intronic
935537148 2:104308082-104308104 CTGTTTATGAGCCAGAAAGTGGG - Intergenic
936760777 2:115778741-115778763 TTGTGTATAAATAAGAGTGTGGG - Intronic
938639195 2:133262704-133262726 CTGTAGATGAATAAGAATGTGGG - Intronic
939009676 2:136831364-136831386 TGGTTTATGAATGAGAAAACAGG + Intronic
939437613 2:142199084-142199106 TTGTTTATGAATCAATAAGGAGG - Intergenic
939545619 2:143549199-143549221 TTTTTTATGAAAAACAATGTAGG + Intronic
939631910 2:144535741-144535763 TTATTTGGGAATAAGAGAGTAGG + Intergenic
939674513 2:145055362-145055384 TTGTTTGTGAATAATAGAGACGG + Intergenic
939804634 2:146758381-146758403 TATTTTATGAATTAGATAGTGGG - Intergenic
940230889 2:151450342-151450364 TTGTTTATTTATAAGACACTTGG + Intronic
941341625 2:164312388-164312410 TTGTTCATTAATACGGAAGTGGG + Intergenic
942291914 2:174481688-174481710 ATGTTTTTGAATAATAAAGCTGG + Exonic
942598423 2:177615526-177615548 CTGATTATTAATAAGAAATTTGG - Exonic
942647100 2:178124511-178124533 TTGTTTTTGAAACATAAAGTGGG + Intronic
943289408 2:186049456-186049478 CTGTCTATGAACCAGAAAGTGGG - Intergenic
943343745 2:186712460-186712482 TTTTTAATGAAAAAGAATGTTGG - Intronic
944205096 2:197150246-197150268 TTCTTTATAAAAATGAAAGTGGG + Intronic
944454733 2:199881288-199881310 TTGGTAATGATTAAAAAAGTTGG - Intergenic
945523529 2:210859750-210859772 TTCTTTATAAATAAGATAGAGGG + Intergenic
945887467 2:215390978-215391000 TTGTTAAAGAATAAAACAGTAGG - Intronic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
946221541 2:218231937-218231959 TTGTATATAAATAAATAAGTAGG + Intronic
946529277 2:220554297-220554319 TTCTTCATGTATAAGAATGTAGG + Intergenic
946588490 2:221217340-221217362 CAGTGGATGAATAAGAAAGTAGG + Intergenic
946796805 2:223362921-223362943 GTGTCTAGGAATCAGAAAGTGGG + Intergenic
947199338 2:227600506-227600528 TTGTAAATAAATAAGAAAGTTGG + Intergenic
947483217 2:230522352-230522374 TTGTTGTTAAATGAGAAAGTGGG + Intronic
948512475 2:238477981-238478003 CTGTCTATGAACCAGAAAGTGGG + Intergenic
948585957 2:239019684-239019706 TTGTTTTTTAATAAGAAAAAAGG - Intergenic
1169462562 20:5808644-5808666 TTGTTTATGAGTAAAAACATGGG - Intronic
1169606268 20:7323079-7323101 CTGTCTATGATCAAGAAAGTTGG - Intergenic
1169966898 20:11227824-11227846 TTGTTTCTGAATCATAAATTTGG + Intergenic
1170338497 20:15297408-15297430 TTCTTAATTAAAAAGAAAGTTGG - Intronic
1170541642 20:17394820-17394842 TAGTTTATGAATTATGAAGTTGG + Intronic
1172168395 20:32913274-32913296 CTGTCTATGAATCAGGAAGTAGG - Intronic
1173093444 20:39999815-39999837 TTGTAAAAGAATAACAAAGTTGG + Intergenic
1173337078 20:42121132-42121154 TTGTCTTTGTATCAGAAAGTGGG - Intronic
1173517457 20:43674836-43674858 TTATTTTAGAAAAAGAAAGTGGG - Intronic
1174623199 20:51892743-51892765 TTATTTATGAAGAAGAGAATTGG - Intergenic
1175826094 20:61937443-61937465 TTTATTAAGAAAAAGAAAGTGGG + Exonic
1176925857 21:14748075-14748097 ATGTTTAAGAATAAGAAAAATGG + Intergenic
1178159671 21:29897186-29897208 TTATTAATGACTTAGAAAGTGGG + Intronic
1178868010 21:36346386-36346408 TATTTTATGCATAAGGAAGTTGG + Intronic
1179056573 21:37941579-37941601 TTGAGTATGAAGAATAAAGTTGG - Intergenic
1179293691 21:40042170-40042192 TTGTTTATGAATCTGAAATTTGG - Intronic
1179426916 21:41288001-41288023 TTGTTTGTGAATACGAAAACTGG + Intergenic
1182514401 22:30845569-30845591 TTGTTTAAAAAAAAAAAAGTGGG + Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1183870862 22:40741149-40741171 CTGTCTATGAACCAGAAAGTGGG + Intergenic
949523138 3:4875499-4875521 TTTGTTAGGAATAAGAAAATTGG + Intronic
950372655 3:12544180-12544202 CTGGTTTTGAATAAGAAAATGGG - Intronic
951170226 3:19533264-19533286 ATGTTTAAGAATAAATAAGTAGG + Intronic
951215831 3:20024217-20024239 ATGTTAATGAATGGGAAAGTGGG - Intergenic
951506628 3:23453394-23453416 CTGTTTTTTAAAAAGAAAGTTGG + Intronic
953726515 3:45403889-45403911 ATGTTAAAGATTAAGAAAGTGGG - Intronic
953802520 3:46036138-46036160 TTGCTGTTGAATGAGAAAGTGGG + Intergenic
954913775 3:54131604-54131626 TTGTTCATGAATAATGAAGTGGG - Intronic
955543216 3:60000090-60000112 CTGCTTATGAACAAGAAAGCAGG - Intronic
956665216 3:71636081-71636103 TCGTTTATGAATAAGATGGACGG + Intergenic
957404665 3:79762205-79762227 CTGTCTATGAAGCAGAAAGTGGG - Intronic
957450733 3:80378605-80378627 CTGTCTATGAATCAGAAAGAAGG - Intergenic
958130553 3:89415321-89415343 TTTTTTAAGATTAAGAATGTAGG - Intronic
958151151 3:89696561-89696583 TTGTTTTTGAAGCAGAATGTGGG - Intergenic
958449019 3:94250265-94250287 TTGTTTGAGAATAAGTAACTCGG - Intergenic
959508965 3:107188618-107188640 TTGTCTATGAACTAGGAAGTGGG - Intergenic
959542787 3:107559045-107559067 TGGTTTGTGTGTAAGAAAGTTGG + Intronic
959545928 3:107596451-107596473 TTTTTTATGGGGAAGAAAGTTGG + Intronic
959910640 3:111759826-111759848 TTGATTAAGAATAAAAAATTTGG - Intronic
960089389 3:113623742-113623764 TTGTTTTTGGATAAGAAAACTGG - Intronic
960698939 3:120421996-120422018 TTGTTTATGAAGAAAATAATAGG - Intronic
960967560 3:123115727-123115749 TTGTTAATGAAAGAGAAAGGAGG + Intronic
961197279 3:125013370-125013392 TTGTTTGTGAGACAGAAAGTGGG + Exonic
961289934 3:125838474-125838496 TCTTTTATGACTAAGAAAGGTGG - Intergenic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
962135141 3:132724010-132724032 TTTTTTAGGATTAAGAAATTTGG - Intergenic
962373719 3:134842193-134842215 CTGTCTATGAATCAGAAAGTGGG + Intronic
963983484 3:151566214-151566236 TAGTTTATGAATTAGGAAGCAGG + Intergenic
964213780 3:154256531-154256553 TTTTTAATTAATTAGAAAGTAGG - Exonic
964673958 3:159256959-159256981 TATTTTATGGATAAGAAAGAGGG + Intronic
964805834 3:160608639-160608661 TCTTCTATGAATAAGAAAGTGGG + Intergenic
965148238 3:164934889-164934911 TTGTTTATTAAAAGGAAAGCAGG - Intergenic
965835131 3:172842822-172842844 TTGTTTTTGAATAAGAAAACTGG - Intergenic
966234945 3:177690294-177690316 TTTTTAATGAAGTAGAAAGTGGG - Intergenic
966288589 3:178327269-178327291 TTGTTTATTATTAAGAACTTAGG - Intergenic
966505334 3:180694452-180694474 TCTTTTATGAACAAGAAAATTGG + Intronic
966772078 3:183512975-183512997 TTCTCTATAAATGAGAAAGTTGG - Intronic
967310194 3:188098750-188098772 GTGATTAGGAATAAGAAGGTTGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967463423 3:189774599-189774621 ATGTTTATAAATTATAAAGTGGG - Intronic
967672668 3:192257319-192257341 TTGTTATTGAATAGGAAATTGGG - Intronic
967833198 3:193939981-193940003 TTTTTTAAGAATAAAAAAGATGG + Intergenic
967935113 3:194721175-194721197 TTGTTTCTGATTAAGAAGTTGGG - Intergenic
968118847 3:196110281-196110303 TGTTTTATGGATAAGAAAATAGG - Intergenic
969007346 4:4031104-4031126 TCTTTTATGACTAAGAAAGGTGG + Intergenic
969362274 4:6672519-6672541 GTGTTTATGATTTAGAATGTTGG + Intergenic
970019544 4:11552051-11552073 TTGTTTATCAATCAGAAAGTTGG + Intergenic
970076661 4:12229635-12229657 CTGTCTATGAATAAGAAAGCAGG + Intergenic
970462796 4:16292409-16292431 CTGTTTATCAATGAGGAAGTGGG + Intergenic
971128187 4:23777278-23777300 TTGGTTGTGAATAAGATAATGGG + Intronic
971621928 4:28865537-28865559 TGATTTATGAGTAAGAAAGCTGG - Intergenic
972036662 4:34531347-34531369 TTTTTTAAAAATAAGTAAGTTGG + Intergenic
973552529 4:52050206-52050228 GTTTTTATGAATAAGTAAATGGG + Intergenic
973794026 4:54405684-54405706 TTGTTTAGGAATAGGAGAGCTGG - Intergenic
974667961 4:64990039-64990061 TAGTTGATAAATAAAAAAGTAGG + Intergenic
974710955 4:65594570-65594592 TCTTTTATGAGTGAGAAAGTAGG + Intronic
974715555 4:65666198-65666220 TTTTGTATGTTTAAGAAAGTGGG - Intronic
975154186 4:71052996-71053018 TTATAAATGAACAAGAAAGTAGG - Intergenic
976336638 4:83895460-83895482 TTGGCTATGAAAAAGAAAGATGG - Intergenic
976553288 4:86421548-86421570 TTGTATCTAAAAAAGAAAGTAGG + Intronic
977035955 4:91953819-91953841 CTGTTTATGAAAAGGTAAGTTGG - Intergenic
977128020 4:93195066-93195088 TTTTTTATGTATAGGATAGTTGG + Intronic
977175120 4:93810189-93810211 TTATTTCTGAAAAAGAAACTAGG - Intergenic
977335550 4:95693957-95693979 TAGTCTATGAACCAGAAAGTGGG - Intergenic
978261355 4:106764052-106764074 ATATTTATAAATATGAAAGTTGG + Intergenic
978483305 4:109219991-109220013 TTGTTTTGTAATTAGAAAGTAGG + Intronic
979076635 4:116278973-116278995 TTGTTGATGTATAAGAATGCTGG - Intergenic
979138606 4:117144514-117144536 CTGTCTATGAATCAGAAAGCAGG + Intergenic
979774038 4:124565174-124565196 TTGTTTTTGAATTAAAAAATAGG - Intergenic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
979814498 4:125083953-125083975 TTGTTTGTGTATTAGGAAGTGGG + Intergenic
980187507 4:129480621-129480643 GTGTTTAGGTATAAGAAAGAGGG - Intergenic
980399855 4:132268803-132268825 TTGTTTAAGAAGATGAAATTTGG - Intergenic
980778944 4:137471710-137471732 TTAGTTATGAATAAGCCAGTTGG + Intergenic
981451094 4:144898608-144898630 TTGTTTATAAATTAGCCAGTTGG + Intergenic
981708852 4:147689050-147689072 TTGATTTAGAATAAAAAAGTAGG - Intergenic
981903899 4:149897069-149897091 TTGTCTATGAGCCAGAAAGTAGG + Intergenic
981953494 4:150441437-150441459 TTCTTTATAAATAATATAGTAGG - Intronic
982470011 4:155776725-155776747 TTGTTTATTAAGAAAAAAGCAGG + Intronic
982523695 4:156451878-156451900 CTGTTTATGAACAAGAAAGCAGG - Intergenic
982876014 4:160650714-160650736 TTCTTTATGAGGGAGAAAGTGGG + Intergenic
982878331 4:160675973-160675995 TGGTTTCTGAATAAGAAATCAGG + Intergenic
983176264 4:164591401-164591423 TTATATAGGAACAAGAAAGTTGG + Intergenic
983322881 4:166215573-166215595 TTGTTAGTGAATACCAAAGTAGG + Intergenic
983573086 4:169231252-169231274 TTATTTATGAGTAACAAATTTGG - Intronic
984111358 4:175619407-175619429 TTATTTATGTATAATGAAGTTGG + Intergenic
985263138 4:188133465-188133487 TTCTTTATAAATGAGAAATTAGG - Intergenic
985364723 4:189216370-189216392 TTGTGTTTGAATAAGTAAATGGG - Intergenic
987209649 5:15667556-15667578 TTGATTCTGTGTAAGAAAGTTGG + Intronic
987972781 5:24971251-24971273 TTGTCTATCATTAATAAAGTTGG - Intergenic
988374474 5:30416387-30416409 TAAATTATGAATAAGAAAGCAGG + Intergenic
988744596 5:34121920-34121942 ATGTTTATGAACCAGCAAGTAGG + Intronic
989012373 5:36887218-36887240 TTAATTATGAAAAAGAGAGTAGG - Intronic
989485861 5:41991267-41991289 TTTGGTAGGAATAAGAAAGTTGG - Intergenic
989684285 5:44066273-44066295 TTGTTGAGGAAAAAGAATGTAGG - Intergenic
990362234 5:55032201-55032223 CTGTTTATGAACCAGAAAGTAGG - Intronic
991133114 5:63149285-63149307 TTCCTGATAAATAAGAAAGTTGG - Intergenic
991346020 5:65668984-65669006 TTGTTTATTAATAATGAAATTGG - Exonic
991517793 5:67458073-67458095 ATGTTTGTGTATGAGAAAGTGGG - Intergenic
992468175 5:77028138-77028160 CTGTTTATGAATAATCTAGTGGG + Intergenic
992940434 5:81755806-81755828 GTGTTTATGAATATGTAAATTGG - Intergenic
993907225 5:93636524-93636546 CTGTCTATGAAAAAGAAAGCAGG + Intronic
994994364 5:107041039-107041061 TTGTTTATGATTCAGGAAATGGG - Intergenic
995030345 5:107473620-107473642 TTGTTAATGAATTAGAATATCGG - Intronic
995613781 5:113939066-113939088 TTGAGTATGAAAAAGAATGTGGG - Intergenic
996009272 5:118462888-118462910 TTATTTATCAATAGGAAAATAGG + Intergenic
996095477 5:119394476-119394498 CTGTGTATAAATAATAAAGTAGG + Intronic
996281056 5:121729355-121729377 TTGTTTAATAAAAAGAAAGAAGG + Intergenic
996352443 5:122560453-122560475 TTATTTATAAATTACAAAGTTGG + Intergenic
996859838 5:128052746-128052768 TTTTTTATCAATAAGGAACTTGG - Intergenic
997128215 5:131249979-131250001 TTGCTTATGAAAATGAAAGTTGG + Intronic
997185434 5:131877198-131877220 TTTTTAATGATTAAAAAAGTAGG + Intronic
997205719 5:132048400-132048422 CTGTCTATGAACCAGAAAGTGGG + Intergenic
997792632 5:136774891-136774913 CTGTGTAGGAATAAGAAAATTGG - Intergenic
997996546 5:138591233-138591255 TTGATTAAGAACAAGCAAGTGGG - Intergenic
998481135 5:142463835-142463857 TTGAAGTTGAATAAGAAAGTAGG + Intergenic
998924026 5:147102748-147102770 TTGTTTATGCAAAAGAATTTTGG - Intergenic
999971307 5:156866612-156866634 TTGTTTCGGAAGCAGAAAGTAGG - Intergenic
1000242831 5:159424518-159424540 TTGTTTATAATTAAGACAGCAGG + Intergenic
1000399283 5:160808748-160808770 TTCTTTATCAATAAGAAATGAGG - Intronic
1000407060 5:160899330-160899352 TTTATTAAAAATAAGAAAGTGGG + Intergenic
1000516716 5:162244784-162244806 TTGTATATGTACAAGAAAATAGG + Intergenic
1000577194 5:162988889-162988911 TCCTCTATGAATGAGAAAGTGGG - Intergenic
1000646151 5:163762677-163762699 TTGAATATGAAGAAGAATGTTGG + Intergenic
1000841198 5:166220627-166220649 TTGTCTATGAACAAGGAAGCAGG - Intergenic
1001355115 5:171013320-171013342 TGGTTTCTCAATAGGAAAGTCGG - Intronic
1002446494 5:179293338-179293360 TTGTTTATGGATCAGAAATCAGG + Intronic
1003345007 6:5259027-5259049 TTGTTTATGAAATAGACTGTTGG - Intronic
1004258662 6:14088509-14088531 TTGCTAATAAAGAAGAAAGTGGG - Intergenic
1004497540 6:16179107-16179129 TTGTTTTTTAATAATAAAGTTGG + Intergenic
1004678611 6:17869657-17869679 GTGTTTCTAAATCAGAAAGTGGG + Intronic
1005227848 6:23663706-23663728 CTGATTATGAACAATAAAGTTGG - Intergenic
1006142376 6:31937698-31937720 TATTTTATAAATAAGAAACTGGG - Intronic
1006384276 6:33720720-33720742 TTGTTTAAAAAAAAAAAAGTTGG - Intergenic
1007857113 6:44869294-44869316 TTGTTTTTGTAGAAGACAGTTGG - Intronic
1008038261 6:46770420-46770442 TTATTTTTTAATAAAAAAGTGGG + Intergenic
1008722144 6:54367875-54367897 TCATTTATGAACAAGAAAGCAGG - Intronic
1009550368 6:65084878-65084900 TTGTGGAGGAATAAGAAAGAGGG + Intronic
1009734367 6:67657559-67657581 TTATTAAGGAATAAAAAAGTAGG - Intergenic
1009811995 6:68680072-68680094 TTGTCTATGAACCAGAAAGTTGG + Intronic
1010603354 6:77858227-77858249 TTGTTTGTGAACAAAAGAGTTGG + Intronic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1011071268 6:83387087-83387109 TTGTTTATGGAAAAGAAACATGG - Intronic
1012016385 6:93857428-93857450 GTGTTTTTTAATAAGAAATTTGG - Intergenic
1012165626 6:95947275-95947297 TTGTTTAGGGATGGGAAAGTGGG + Intergenic
1013249056 6:108316079-108316101 TTGTTTAAAAATCGGAAAGTTGG + Intronic
1013564976 6:111349174-111349196 TTGTTTAGAAATAAGATATTCGG - Intronic
1013717934 6:112985672-112985694 GTGTTTATACATAAGAAATTGGG - Intergenic
1013807492 6:114011574-114011596 GTGTTTATGGATAAGAGAGCAGG - Intergenic
1014072432 6:117198557-117198579 TTTTGTATGAGTAAGAAAATAGG - Intergenic
1014521424 6:122447813-122447835 TCTTTTATAAAGAAGAAAGTAGG + Intronic
1014554194 6:122826097-122826119 TTGATTTTGCATAAGACAGTAGG - Intergenic
1014889104 6:126820195-126820217 TTGATAAGGAAGAAGAAAGTTGG - Intergenic
1016927334 6:149364000-149364022 TTGGTGATGAATTAGAAATTGGG - Intronic
1018496456 6:164351335-164351357 ATGTTCAAGAATAAGGAAGTAGG + Intergenic
1019077842 6:169404501-169404523 TTGTTTATGAATAAATAAAAAGG - Intergenic
1019570737 7:1710869-1710891 TTATCTATAAATGAGAAAGTTGG - Intronic
1019718439 7:2553947-2553969 TTCTTTCTGATTATGAAAGTAGG - Intronic
1020969425 7:14916009-14916031 TAGTTTATGGATAAGTAAGATGG + Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021656342 7:22878076-22878098 TTTTTTATGTATAAAAAAGATGG + Intergenic
1022323701 7:29310698-29310720 CTGTTTATGAATCAGGAAATGGG - Intronic
1023015576 7:35966925-35966947 TTGTGTATGAATGAAAAAGAGGG + Intergenic
1023130575 7:36998931-36998953 TTATTTATTATTAAGAATGTGGG + Intronic
1023787306 7:43720474-43720496 TTGTTTAAGAATAAAAATATGGG + Intronic
1024065356 7:45727758-45727780 TTGTGTATGAATGAAAAAGAGGG - Intergenic
1024632077 7:51257538-51257560 TTCATTCTGCATAAGAAAGTAGG + Intronic
1026332999 7:69369326-69369348 TTTTTTATAAAACAGAAAGTGGG + Intergenic
1028286520 7:89009710-89009732 CTGTTTATGAACCAGAAAGTGGG + Intronic
1028484387 7:91342205-91342227 TTTTTTATAAATAAGTAACTGGG - Intergenic
1028557636 7:92140534-92140556 TTGAAAATGAATAAGAAAGTTGG - Intronic
1029047788 7:97649036-97649058 TCATTTATGAGTAATAAAGTTGG - Intergenic
1029908112 7:104112892-104112914 TTCTTGATGAATAATAATGTTGG + Intergenic
1030031536 7:105374235-105374257 TTAATGAAGAATAAGAAAGTTGG - Intronic
1030422158 7:109321125-109321147 CCATTTATGAATCAGAAAGTTGG - Intergenic
1030878292 7:114843282-114843304 TTGCTTCTGAAACAGAAAGTGGG - Intergenic
1030913174 7:115278464-115278486 CTTTTTATGTAGAAGAAAGTTGG + Intergenic
1030917792 7:115338545-115338567 TTTCTTAGGAATAAGAATGTAGG - Intergenic
1031065344 7:117098590-117098612 CTGTTTATGAATGAGACAATGGG - Intronic
1031633415 7:124072173-124072195 TCGTTTATGAATAACAAATTTGG + Intergenic
1031637856 7:124123079-124123101 CTGTTTATGAATCAAAAAGGAGG - Intergenic
1031774187 7:125885710-125885732 CTGTCTCTGAATAAGGAAGTAGG + Intergenic
1031895467 7:127342923-127342945 TTCTTTATTAAAAAGAAAGTAGG + Intergenic
1033400345 7:141016888-141016910 TTACTTATCAATAGGAAAGTTGG + Intergenic
1035655915 8:1304555-1304577 TTGTTTTAAAAGAAGAAAGTAGG + Intergenic
1036956633 8:13194705-13194727 TTTGTTATGGATAAGAAAGCAGG + Intronic
1037714272 8:21383666-21383688 TTGTTGATAAACAAGATAGTGGG - Intergenic
1037929347 8:22868505-22868527 TTGTTTGTGTATATGAAATTGGG - Intronic
1037973758 8:23193883-23193905 TTGCTGCTGAATGAGAAAGTAGG + Intronic
1038104052 8:24413664-24413686 ATATCTATGAATAAGAACGTTGG + Intergenic
1038222006 8:25618226-25618248 TTGTTTATAAATGACAAAGAAGG + Intergenic
1038298246 8:26316708-26316730 TTGTCTCTGAACCAGAAAGTAGG - Intronic
1039199063 8:35067321-35067343 TTGTCTATGAATGTGAAACTTGG + Intergenic
1040449000 8:47525411-47525433 TGGTTAAAGAAAAAGAAAGTAGG - Intronic
1040740154 8:50564035-50564057 GTGTCTTTGAAAAAGAAAGTTGG - Intronic
1041133408 8:54728577-54728599 TTATTTATTAAGAAGAAAGATGG + Intergenic
1041316297 8:56566175-56566197 TTATTTTTGAATAATAAATTAGG - Intergenic
1041674300 8:60522509-60522531 TTTTTTTTAAAAAAGAAAGTAGG - Intronic
1041979609 8:63842022-63842044 TTATTTATCAAGCAGAAAGTAGG + Intergenic
1042246680 8:66715135-66715157 TGGTTTTTGAAAAAGAAAATAGG + Intronic
1042831846 8:73038729-73038751 CTGACTATGAATAAGAAAGAAGG + Intronic
1044013924 8:87027725-87027747 TTGCTGTTGAATGAGAAAGTGGG - Intronic
1044117780 8:88355444-88355466 TTGCTTGTTAATAAGAAATTGGG + Intergenic
1044133299 8:88554234-88554256 GTGTTTATGAAAAACAAAGGTGG - Intergenic
1044844665 8:96368786-96368808 TTGTAAAAGAATAATAAAGTGGG - Intergenic
1045099995 8:98834608-98834630 CTGTCTATGAATCAGGAAGTTGG - Intronic
1045100203 8:98836302-98836324 CTGTCTATGAATCAGGAAGTTGG - Intronic
1045129741 8:99137601-99137623 TTGTTTTTGATGAAGAAAGAAGG + Intronic
1045248557 8:100464424-100464446 TTTTTTCAGAATTAGAAAGTAGG + Intergenic
1045717397 8:105064618-105064640 TTGTTTATAAAAATGAAATTTGG + Intronic
1046238785 8:111463580-111463602 CTGTCTATGAATCAGTAAGTGGG - Intergenic
1046252936 8:111657073-111657095 TGCTTTATAAAAAAGAAAGTAGG + Intergenic
1046264048 8:111807755-111807777 CTGTCTATGAATCAGAAAGCAGG - Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1046897078 8:119484589-119484611 TTTTATATGAATGAGACAGTTGG - Intergenic
1046964189 8:120145047-120145069 TTGTAGATCAATAAGAAAATGGG + Intronic
1047586403 8:126278508-126278530 TTTATTATGATTGAGAAAGTAGG + Intergenic
1048386962 8:133921097-133921119 GTGTTTATGAATGGGAAAGGAGG + Intergenic
1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG + Intergenic
1050142836 9:2534259-2534281 TTTTTTTTGAAGAAGTAAGTAGG - Intergenic
1050772567 9:9220915-9220937 TGGTGTATGAGTAGGAAAGTAGG + Intronic
1051583638 9:18704428-18704450 TTGTTTTCGAATCAGAAAGATGG - Intronic
1051769995 9:20567059-20567081 TCATTTATGGATTAGAAAGTGGG + Intronic
1052551769 9:29959844-29959866 TTGTTTATGGATAAGAAATCTGG + Intergenic
1052587944 9:30453038-30453060 TTGACTATGAATCAGGAAGTGGG - Intergenic
1053574094 9:39340379-39340401 TAGTTTTAGAAGAAGAAAGTAGG - Intergenic
1053625183 9:39862799-39862821 TAGTTTTAGAAGAAGAAAGTGGG - Intergenic
1053838654 9:42168624-42168646 TAGTTTTAGAAGAAGAAAGTAGG - Intergenic
1053879688 9:42580427-42580449 TAGTTTTAGAAGAAGAAAGTGGG + Intergenic
1053892979 9:42713892-42713914 TAGTTTTAGAAGAAGAAAGTGGG - Intergenic
1054095659 9:60899071-60899093 TAGTTTTAGAAGAAGAAAGTAGG - Intergenic
1054117120 9:61175010-61175032 TAGTTTTAGAAGAAGAAAGTAGG - Intergenic
1054218711 9:62387895-62387917 TAGTTTTAGAAGAAGAAAGTGGG + Intergenic
1054232005 9:62521272-62521294 TAGTTTTAGAAGAAGAAAGTGGG - Intergenic
1054590637 9:67007558-67007580 TAGTTTTAGAAGAAGAAAGTAGG + Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1054935570 9:70684016-70684038 TTGTTTAGAATTAAGAAATTAGG + Intronic
1055329813 9:75171943-75171965 TTGTTTAAGATATAGAAAGTAGG + Intergenic
1055376954 9:75659008-75659030 ATGTTTATGACTGAGTAAGTAGG - Intergenic
1055590751 9:77811233-77811255 GTGATAATGAATAAGAAATTAGG + Intronic
1055881020 9:81003532-81003554 TTGTCTATGAACCAGAAAGGGGG - Intergenic
1056219278 9:84435456-84435478 TTGTCTATGAGCCAGAAAGTGGG - Intergenic
1057711773 9:97451920-97451942 TTGTTGTTGAATGAGAAAATAGG + Intronic
1058380814 9:104375233-104375255 TTGCTTATGAAAAAAAAAGTTGG - Intergenic
1058997127 9:110309973-110309995 TTTATTAAGAAAAAGAAAGTGGG + Intronic
1059782888 9:117548494-117548516 TTATTTATGAAAAAGGCAGTGGG - Intergenic
1061102280 9:128501254-128501276 TGGTTTCTGAATAAGAATCTGGG + Exonic
1186096006 X:6102476-6102498 CTGTCTATGAATCAGGAAGTGGG + Intronic
1186316585 X:8377277-8377299 TGATTTAAGAATAAGAATGTAGG - Intergenic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1187347844 X:18483252-18483274 TTCTTAATGAATGAGAAAATAGG + Intronic
1187598772 X:20803485-20803507 ATATATATGAATAATAAAGTAGG + Intergenic
1188089759 X:25949979-25950001 GTTTTTATGAAAAAGAAATTCGG + Intergenic
1188760840 X:34027411-34027433 TTGTTTATGAGCCAGGAAGTGGG + Intergenic
1189654608 X:43230320-43230342 TTGATAAAGAATAATAAAGTGGG + Intergenic
1189724011 X:43950519-43950541 TAGTTTCTGAATAAGAAAATAGG + Intronic
1189928436 X:45982307-45982329 TTGTTTATGAATATGAAATTTGG - Intergenic
1190434495 X:50409925-50409947 TTGTCTATGAACCAGGAAGTGGG + Intronic
1192627454 X:72745104-72745126 TTATTTATAAATAAGAAAACAGG - Intergenic
1192654254 X:72975709-72975731 TTATTTATAAATAAGAAAACAGG + Intergenic
1193458633 X:81762113-81762135 CTGTCTGTGAATCAGAAAGTGGG - Intergenic
1193570484 X:83135775-83135797 CTGTTAAAGAATAAGAAGGTGGG - Intergenic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1193909927 X:87291697-87291719 TCATTTATGACTAAGAAGGTTGG - Intergenic
1193934019 X:87592926-87592948 TTCTTTAAGAATAGGCAAGTGGG - Intronic
1194661333 X:96631046-96631068 TTGTTTATGAAAAAAAAAACAGG + Intergenic
1194817999 X:98468989-98469011 TCTTTTATTAACAAGAAAGTGGG - Intergenic
1194893691 X:99412684-99412706 TTGGTTAAGAAGAACAAAGTTGG - Intergenic
1195175731 X:102313658-102313680 TAGTTTTAAAATAAGAAAGTAGG - Intronic
1195183133 X:102373435-102373457 TAGTTTTAAAATAAGAAAGTAGG + Intronic
1195362697 X:104099875-104099897 TTCTTAATGAAATAGAAAGTAGG + Exonic
1197195449 X:123695106-123695128 TTATATATGACTAAGAAAGAGGG - Intronic
1197915761 X:131532985-131533007 ATTTTTATAAAGAAGAAAGTTGG - Intergenic
1198792829 X:140364324-140364346 CTGTCTATGAACCAGAAAGTGGG + Intergenic
1198941493 X:141962150-141962172 TATTTTAAGCATAAGAAAGTGGG - Intergenic
1199503221 X:148532797-148532819 TTGTTTATGTCTAAGTAATTTGG - Intronic
1199789308 X:151137205-151137227 TTGTTGTTGAATGAGAAAGCAGG - Intergenic
1201577966 Y:15480272-15480294 TTGTTTCTGAATCAGAAAAAAGG - Intergenic
1201777059 Y:17677417-17677439 TTGTTTTTGATTAAGCAGGTTGG - Intergenic
1201824498 Y:18228575-18228597 TTGTTTTTGATTAAGCAGGTTGG + Intergenic
1201885012 Y:18872679-18872701 CTGTCTATGAATGAGAAAGTGGG - Intergenic