ID: 1115508881

View in Genome Browser
Species Human (GRCh38)
Location 14:34120343-34120365
Sequence CTGAGTTAGGGCAAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 343}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115508881_1115508888 -9 Left 1115508881 14:34120343-34120365 CCAGCCCCCTTGCCCTAACTCAG 0: 1
1: 0
2: 1
3: 37
4: 343
Right 1115508888 14:34120357-34120379 CTAACTCAGTATGATTCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 98
1115508881_1115508889 -8 Left 1115508881 14:34120343-34120365 CCAGCCCCCTTGCCCTAACTCAG 0: 1
1: 0
2: 1
3: 37
4: 343
Right 1115508889 14:34120358-34120380 TAACTCAGTATGATTCTGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 132
1115508881_1115508892 19 Left 1115508881 14:34120343-34120365 CCAGCCCCCTTGCCCTAACTCAG 0: 1
1: 0
2: 1
3: 37
4: 343
Right 1115508892 14:34120385-34120407 CCCAGCTTCAGAGCTCCCTCTGG 0: 1
1: 3
2: 24
3: 96
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115508881 Original CRISPR CTGAGTTAGGGCAAGGGGGC TGG (reversed) Intronic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900416421 1:2537280-2537302 GGGAGTTAGGGCAGCGGGGCAGG - Intergenic
900541652 1:3205956-3205978 CTGAGTCAGGGCAGGGGGCTGGG - Intronic
900998040 1:6133457-6133479 CTGGGTTTGAGCAAGGGGCCTGG + Intronic
901757605 1:11450861-11450883 CTGATGTAGGGGATGGGGGCAGG - Intergenic
902285628 1:15406739-15406761 CTGAGTGGGGGCAAAGAGGCAGG - Intergenic
903827262 1:26155300-26155322 CTCAGTGAGGGCAAGAGGCCAGG - Intergenic
904769278 1:32871851-32871873 CTGAGATGAGGGAAGGGGGCTGG - Intronic
904963626 1:34354737-34354759 CTGAATTAAGGTAAGGGGGTTGG - Intergenic
906545296 1:46616006-46616028 CTCAGTGAGGGCATGGGGGTGGG - Intronic
906877614 1:49556376-49556398 GTGAGGTGGGGGAAGGGGGCAGG + Intronic
907230730 1:52996079-52996101 CTGAGGTAGAGAAAAGGGGCAGG - Intronic
907613805 1:55902256-55902278 ATGAATAAGGGCAAAGGGGCCGG - Intergenic
908393638 1:63705607-63705629 CTGACTTGGGGCAAAGAGGCTGG - Intergenic
910685083 1:89907807-89907829 ATCAGTTGGCGCAAGGGGGCTGG - Intronic
912801158 1:112720476-112720498 CTGGGAGAGGGCAAGGGGGTGGG - Exonic
913161266 1:116148075-116148097 CTGAGTTGGGGTGAGGGGCCTGG - Intergenic
915905109 1:159871798-159871820 CTGAGTTCGGGTGAGGGGACTGG + Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916844413 1:168634496-168634518 TTGGGTTAGGCCAAGGAGGCTGG + Intergenic
918356459 1:183709835-183709857 CTGAGTTGGGGGAATTGGGCTGG + Intronic
920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG + Intronic
920977370 1:210798457-210798479 AGGAGTGAGGGCAAAGGGGCAGG + Intronic
921036496 1:211383883-211383905 TTGAGGTAGAGGAAGGGGGCTGG - Intergenic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
922378553 1:224996592-224996614 CTGAGTTAGGGTAGGGAAGCTGG + Intronic
922990706 1:229908563-229908585 CTGAGATGAGGCAAGGGGGAAGG + Intergenic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
924416454 1:243861233-243861255 CTGAACTGAGGCAAGGGGGCTGG - Intergenic
1062934127 10:1373689-1373711 CCCAGTGAGGGCAAGAGGGCAGG - Intronic
1062951050 10:1503799-1503821 CAGAGTAGGAGCAAGGGGGCGGG - Intronic
1063027981 10:2201867-2201889 TTGAGTTAAGACAAGGGGGTGGG + Intergenic
1065113882 10:22465306-22465328 CTCATTTAGGGAATGGGGGCTGG + Intergenic
1065222625 10:23511865-23511887 CTCAGGAAGGGCAAGGGGTCAGG - Intergenic
1067435178 10:46272091-46272113 CTGAGTCAGGGTCAGGGGTCTGG - Intergenic
1067438539 10:46295225-46295247 CTGAGTCAGGGTCAGGGGTCTGG + Intronic
1068508273 10:57930627-57930649 TTGACTAAGGGCATGGGGGCTGG - Intergenic
1069755613 10:70772871-70772893 GTGAGTCAGGGCTAGGGGGAGGG - Intronic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070311259 10:75275724-75275746 CAGACTGAGGGCAAGGGGGCTGG + Intergenic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070719205 10:78744811-78744833 CTGAGTTCAGGCAAAGGGGTTGG + Intergenic
1072614658 10:97041429-97041451 CAGAGTTGGGGCATGGGGGCCGG + Intronic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1072813957 10:98486543-98486565 GTGAGTCAGGGAAAGGAGGCTGG + Intronic
1073865321 10:107796720-107796742 CTGAGTTAGGTCAGAGTGGCAGG - Intergenic
1074829697 10:117240351-117240373 CAGAGAAAGGGCTAGGGGGCGGG - Intergenic
1075945360 10:126428282-126428304 CTGGGGTAGGGAAAGTGGGCTGG + Intronic
1076181724 10:128414609-128414631 CAGAGCTATGGCAAGGGGGTTGG + Intergenic
1076274069 10:129181848-129181870 CTCAGGTAGGGCAAGCGGGCAGG - Intergenic
1076880992 10:133239194-133239216 CTAAGTTAAGGAATGGGGGCTGG - Intronic
1077220988 11:1416102-1416124 CCGAGCTAGGGCAAGGGGAGGGG + Intronic
1077445196 11:2587547-2587569 CTGAGGTCGGGCAGGGGGACAGG - Intronic
1077600662 11:3572369-3572391 CAGAGTTAGTACAAGAGGGCCGG - Intergenic
1079103255 11:17554554-17554576 CTGAGTTAGGGTCAAGGGGTTGG + Intronic
1080574092 11:33582685-33582707 GTGTCTCAGGGCAAGGGGGCTGG - Intronic
1081931024 11:46871525-46871547 CTGTGTGAGGGCAAAGGGGTGGG + Exonic
1083680440 11:64349292-64349314 CAGGCTCAGGGCAAGGGGGCAGG - Intronic
1083904530 11:65661563-65661585 CTGAGTCAGGGCAAGGAGTGAGG + Intronic
1084168288 11:67387323-67387345 CTGACTTTTGGCAAGGGGGTGGG + Intronic
1084171754 11:67404345-67404367 CAGAGCCAGGGTAAGGGGGCAGG + Exonic
1084172112 11:67405754-67405776 CTGGGCTAGGGAAAGTGGGCTGG - Intronic
1084857453 11:71998115-71998137 CAGAGTCAGGCCAAGGGGGGAGG - Intergenic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1085302813 11:75468295-75468317 CTGCCTCAGGGCAAGGGGACAGG - Intronic
1085472115 11:76765028-76765050 CCAAGTTGGGGCAAGGGGCCTGG + Intergenic
1085527047 11:77170364-77170386 CTCAGGCAGGGCAAGGAGGCTGG + Intronic
1087065734 11:94026448-94026470 CTGAGGTAGGGGAGGGGAGCAGG - Intronic
1088889041 11:114030440-114030462 CAGAGAGAGGCCAAGGGGGCAGG - Intergenic
1089200546 11:116722364-116722386 CTGAGTTAGGTCCAGGTGGTTGG - Intergenic
1090317525 11:125807052-125807074 CTGACTGAGGGCCAGGAGGCAGG + Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090464748 11:126924180-126924202 CTGAGCCAGGGAAAGGGGGAAGG - Intronic
1093235570 12:16605446-16605468 CTGTGTTTGGGCATGGGGGCGGG - Intronic
1094020076 12:25904713-25904735 CTGAATTGAGGCAAGGGTGCAGG - Intergenic
1094248061 12:28325789-28325811 TAGAGGTAGGGCAAGGGGGTGGG + Intronic
1094719999 12:33053121-33053143 CTGCCTGAGGGCAAGGGGCCAGG - Intergenic
1098204977 12:68099153-68099175 CTGAGTTAAGGCAAGTTGGGAGG - Intergenic
1099669174 12:85668756-85668778 ATGAGTTAGGGCAAAGGTGTTGG - Intergenic
1102470554 12:113157668-113157690 CTGTGTCAGGGCTAGGAGGCAGG - Exonic
1102571653 12:113830556-113830578 CTGAGCTAGGGCTGCGGGGCGGG + Intronic
1102644844 12:114397146-114397168 ATGAATTTGGTCAAGGGGGCGGG - Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1104987936 12:132607547-132607569 CTGCGCTAGGGCCAGGGGGCTGG + Intronic
1105325915 13:19370587-19370609 CTGAATCAAGGCAAGGGGGCCGG + Intergenic
1105489019 13:20869450-20869472 CTTAATTTGGGAAAGGGGGCTGG + Intronic
1105867592 13:24474507-24474529 CTGAATCAAGGCAAGGGGGCCGG - Intronic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1107264820 13:38540885-38540907 ATGAGTTAGGCCAAGGTGGGTGG + Intergenic
1108276980 13:48820942-48820964 GTGAGTGAGGGGAAGTGGGCTGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1112135098 13:96569362-96569384 CAGACTTATGGCAAGGTGGCTGG - Intronic
1113156368 13:107327278-107327300 CTGAGTGAGGACAAGAGGCCAGG - Intronic
1113218734 13:108073679-108073701 CTGAGTAAGTGCCAGGGGGTAGG + Intergenic
1113636605 13:111923293-111923315 CTGAGGAAGGGCCAGGGTGCCGG + Intergenic
1113731894 13:112647571-112647593 CCGAGCTTGGGCAAGGAGGCCGG + Exonic
1114616753 14:24072520-24072542 CTAAACTAGGGCAAGGGGGTGGG - Intronic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1115804756 14:37038393-37038415 CTGAGTTTGGGAAAGGGGAGAGG - Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1119603025 14:75990103-75990125 GTGAGTTAGGGCAGGGGGACTGG + Intronic
1121445126 14:93973873-93973895 CTGTGCTAGGGCAGGGGTGCTGG - Intronic
1122108733 14:99480727-99480749 CTGCGCTAGGGGAAGCGGGCAGG - Exonic
1122404317 14:101490962-101490984 CTGAATTGAGGCCAGGGGGCAGG - Intergenic
1122688618 14:103521501-103521523 CCGAGGTGGGGCACGGGGGCGGG - Intronic
1122864904 14:104599302-104599324 CTGGGTTTGGGCAATGGGGTGGG + Intronic
1122951499 14:105047526-105047548 CTGAGTGAGGTCAAGCGGGGCGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1126142813 15:45451488-45451510 CTGAGCCAGGGCCAGGAGGCAGG + Intergenic
1127174214 15:56336771-56336793 CTGAATTAGGGCAAGGGAATTGG + Intronic
1127358180 15:58221762-58221784 CTGAGTTGGGACAAGGTGACTGG - Intronic
1127630040 15:60819825-60819847 CTGAGACAGGGCAGAGGGGCCGG - Intronic
1127702506 15:61514745-61514767 CTGAGTTGGGGCAGAGGGTCTGG + Intergenic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128354920 15:66919358-66919380 CTGAGCAGGGGCAAGGAGGCAGG + Intergenic
1128526210 15:68414143-68414165 GAGACTTAGGGCAAGTGGGCAGG + Intronic
1129324054 15:74790282-74790304 CAGAGTTTTGGCAAGGGGGAAGG + Intronic
1130224359 15:82046087-82046109 CTGAGTGAGGGCGGGCGGGCGGG - Exonic
1130385479 15:83407517-83407539 CTGAGTTCAGGCGAGGGGGCTGG - Intergenic
1130854180 15:87826423-87826445 TTGACTTAGGGCAGGTGGGCAGG + Intergenic
1131150486 15:90044423-90044445 CTGAGTGTGAGGAAGGGGGCCGG + Intronic
1131301401 15:91202792-91202814 CTGAGTTGGGTCAATGGGCCTGG + Intronic
1132546873 16:537270-537292 CTGAGTGAGCGCAGGGGAGCAGG + Intronic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1133060509 16:3171625-3171647 CTGAGTCAGGGCAGAGGCGCTGG + Intergenic
1133101458 16:3482633-3482655 GTGGGGTAGGGCAAGGGGGTGGG - Intronic
1133371462 16:5248691-5248713 CAGAGTTAGGACAAGAGGGCCGG + Intergenic
1133576656 16:7097845-7097867 CTGAGTTAGGGAGAAGGGGTTGG + Intronic
1134377317 16:13689348-13689370 CTCAGTTAGGGTAAGGGTGTTGG - Intergenic
1136056320 16:27692543-27692565 CTGAGGAGTGGCAAGGGGGCTGG - Intronic
1136229381 16:28877778-28877800 CTGAGTTAGAGCGATGGGGAAGG + Intergenic
1136703532 16:32165660-32165682 CTGAGTGAGGGCCAGCGTGCCGG + Intergenic
1136764170 16:32761942-32761964 CTGAGTGAGGGCCAGCGTGCCGG - Intergenic
1136803928 16:33108444-33108466 CTGAGTGAGGGCCAGCGTGCCGG + Intergenic
1138625356 16:58247418-58247440 CGGAGTGAGGGCCAGGGAGCAGG + Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140827122 16:78716931-78716953 CTGATCTTGGGAAAGGGGGCAGG - Intronic
1141476227 16:84275281-84275303 CTGGGGTTGGGCGAGGGGGCTGG - Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1203066524 16_KI270728v1_random:1024064-1024086 CTGAGTGAGGGCCAGCGTGCCGG - Intergenic
1143342386 17:6223084-6223106 CTGAGTTGGGGGGAGGGGGGAGG + Intergenic
1144662446 17:17080039-17080061 CTGAGAGAGGGCATGGGGGCAGG + Intronic
1144739375 17:17572672-17572694 CTGCGTGAGGGCCAGGGGCCGGG + Intronic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1148075119 17:44931321-44931343 CTGGGTCAGGGCAGGGCGGCTGG - Intronic
1148713289 17:49697562-49697584 CTGAGTTAGGCCAAGAGTGGTGG + Intergenic
1149582901 17:57763531-57763553 CTGAGGCAGGGAAATGGGGCAGG + Intergenic
1150271781 17:63871487-63871509 CTGAATTAGGGCAAGGGAAGTGG - Intergenic
1150275331 17:63894384-63894406 CTGAATTAGGGCAAGGGAAGTGG - Intergenic
1150277457 17:63909073-63909095 CTGAATTAGGGCAAGGGAAGTGG - Intergenic
1151728819 17:75899139-75899161 CTGGGTAAGGGCCATGGGGCTGG - Exonic
1152374621 17:79912796-79912818 CCGAGTTGGGGAAAGAGGGCTGG + Intergenic
1152654636 17:81514066-81514088 GCGAGTCAGGGCAAGGCGGCCGG + Intronic
1152664505 17:81559471-81559493 CAGAGTGTGGGCATGGGGGCAGG + Intronic
1152739586 17:82013090-82013112 CTGAGCTGGGGCAAGAAGGCTGG + Intronic
1152850179 17:82629221-82629243 CAGAGGTAGGGCAAGGGAGGCGG + Intronic
1153608111 18:6854979-6855001 CTGAGGGGGGCCAAGGGGGCAGG - Intronic
1154214538 18:12406600-12406622 ATGAGATAGGGCGAGAGGGCAGG - Intergenic
1157798888 18:50602452-50602474 CTGAGCTAGGCTCAGGGGGCAGG - Intronic
1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG + Intergenic
1159626571 18:70702137-70702159 CTGAGTTAAGGCAATGGGATAGG - Intergenic
1160385027 18:78491690-78491712 TTGAGTTTGGGCAGGTGGGCTGG + Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160816004 19:1036107-1036129 CTGGGTGAGGGAAAGGGGCCGGG - Intronic
1160906683 19:1454989-1455011 CCGAGCTAGGGTAAGGGGGGGGG - Intronic
1161774747 19:6254137-6254159 CTTAGGGAGGGCAAAGGGGCTGG + Intronic
1162350404 19:10145407-10145429 CTGAACTAAGGCAAGGGAGCTGG + Intronic
1163476361 19:17528430-17528452 CTGATTTAGGGCAGGGGTTCAGG + Intronic
1163517794 19:17775354-17775376 CTGAGTCAAGGCCTGGGGGCAGG + Intronic
1164009550 19:21188013-21188035 CTGAGATAGGCCAAGGAGGGTGG + Exonic
1164651618 19:29894961-29894983 CTGAGTTAAGGAATGGGTGCAGG + Intergenic
1165249467 19:34517628-34517650 CTGAGTTAAGGCAATGAGTCTGG - Intergenic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165495394 19:36149744-36149766 CTGGGTGAGGGCAAAGGGGCTGG + Intronic
1165607301 19:37116665-37116687 CTCAGTAAGTGCAAGGGGTCAGG + Intronic
1166375635 19:42325573-42325595 CTGTGGGAGGGCGAGGGGGCGGG - Intergenic
1166738527 19:45100327-45100349 CTGCAGTAGGGCATGGGGGCAGG + Intronic
1167910300 19:52696530-52696552 CTTTGCTAGGGCAAGGGGGTTGG + Intergenic
1168097060 19:54121940-54121962 CTGAGTGAGTGCTGGGGGGCAGG + Exonic
1168652137 19:58098073-58098095 CAGCGTTAGGGAAAGGGGCCAGG - Intronic
927683903 2:25157914-25157936 CTGTGTATGGGAAAGGGGGCTGG - Exonic
928173736 2:29020530-29020552 CAGAGGTAGGGCAAAGGGGGAGG + Intronic
928759788 2:34568665-34568687 CTGAATTGGGACAAGGGGACTGG + Intergenic
931121689 2:59226590-59226612 CTTATTCAGGGCAAGGGGGAGGG + Intergenic
932301790 2:70672621-70672643 CTGAGTTGGGGCAAGGAGCCGGG + Intronic
934638339 2:96010674-96010696 CTGAGTTAGGGCTCGCGGGGCGG - Intergenic
934704091 2:96464248-96464270 CTGAGCTAGGGTGAGAGGGCTGG - Intergenic
934795316 2:97094737-97094759 CTGAGTTAGGGCTCGCGGGGCGG + Exonic
935402912 2:102679240-102679262 CTGAGTTACAGCAAGGTGTCTGG + Intronic
935422094 2:102879963-102879985 CTCAGGAAGGGCAAGGGGTCAGG - Intergenic
936450062 2:112627145-112627167 CTGACTTAGGGTAAGATGGCAGG + Intergenic
936882396 2:117269784-117269806 CTGCCTTTGGGCAAGGGGTCTGG - Intergenic
937090232 2:119201367-119201389 CTGACTTGAGGCAAGGGAGCTGG + Intergenic
937883678 2:126886281-126886303 CTGGGCTAGGGCCAGGTGGCCGG - Intergenic
938937959 2:136144484-136144506 CTGAGTTGGGCTGAGGGGGCTGG - Intergenic
939557375 2:143692194-143692216 CTAAATTGGGGCAGGGGGGCAGG + Intronic
940052730 2:149480873-149480895 CTGAGGTAGGTGATGGGGGCTGG - Intergenic
940190209 2:151032725-151032747 CTGAGTGATGCCAATGGGGCTGG - Intronic
943168020 2:184357239-184357261 TTGAGATAGAGCAAGGAGGCTGG + Intergenic
945155528 2:206833711-206833733 CTGAATTAGGGTAAGGGAGACGG + Intergenic
945355176 2:208831765-208831787 CTCAGGAAGGGCAAGGGGTCAGG + Intronic
946160300 2:217831627-217831649 CTTAGTGAGGGCTGGGGGGCTGG + Intronic
946593777 2:221282564-221282586 ATGAGTATGGCCAAGGGGGCAGG - Intergenic
946869423 2:224072460-224072482 ATGATTTAAGGCAAGAGGGCTGG + Intergenic
947462222 2:230313459-230313481 CTGCTTTCAGGCAAGGGGGCTGG - Intergenic
947623962 2:231607888-231607910 CTGAGTTGAGGCAAGAGGGCTGG - Intergenic
947739448 2:232478497-232478519 CGGGGTGAGGGCAAGAGGGCTGG + Intergenic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948188255 2:236038371-236038393 CTGAATTAGGTCGAGGTGGCAGG - Intronic
948487539 2:238290284-238290306 ATGTGTTAGGGAGAGGGGGCGGG - Intergenic
948657781 2:239487312-239487334 CTGAGTGAGGCCAGGGCGGCAGG + Intergenic
948687366 2:239677600-239677622 CTGAGGTGGGGCAGGGAGGCCGG - Intergenic
948912007 2:241009541-241009563 ATGAGAAAGGGCACGGGGGCTGG + Intronic
1168923546 20:1560693-1560715 CTGAGTTAGGATAAGAGAGCTGG + Intronic
1169248454 20:4042235-4042257 CTGCATTAGGGCAAGGGTGGTGG + Intergenic
1169275771 20:4232846-4232868 CTGTGCTGAGGCAAGGGGGCCGG - Intronic
1169832383 20:9838876-9838898 CTGGGTAGGGGCAAGGGGGGCGG + Exonic
1170436896 20:16339640-16339662 CTGAGATGGGGAAAGGGAGCAGG - Intronic
1174037638 20:47678044-47678066 CTGAGTCAGGGCGGGGAGGCTGG - Intronic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175279675 20:57794713-57794735 CTGAGTTGGGGCAAAGGTCCAGG - Intergenic
1175935255 20:62511018-62511040 CTGAGTTGGGGCAGGAAGGCAGG + Intergenic
1178485825 21:33019829-33019851 TTGAGTTTAGACAAGGGGGCGGG - Intergenic
1178703951 21:34857692-34857714 TTGAATTATGGCAAGGGGCCTGG - Intronic
1179152723 21:38822427-38822449 CTGAGCTGGGGCCAGGGAGCAGG + Intronic
1179264300 21:39789070-39789092 CTGACTTAGGGCAAGGGAAGAGG + Intronic
1180028054 21:45179920-45179942 GTGAGAGAGGGCAAGGGGGGTGG + Intronic
1180053528 21:45344941-45344963 CGGCTTTCGGGCAAGGGGGCAGG - Intergenic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1181304600 22:21908033-21908055 GTGAGTTAGGGAAAAGGGGAAGG + Intergenic
1181729037 22:24831356-24831378 CTGAGTTGGGGCAAAGTGGCTGG + Intronic
1182386782 22:29949941-29949963 CTGATTTGGGGCAAGGTGTCGGG + Intronic
1184335293 22:43849272-43849294 CTGTGATAGGGACAGGGGGCAGG + Intronic
950144247 3:10636399-10636421 CTCACTCAGGCCAAGGGGGCTGG + Intronic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950451433 3:13067854-13067876 GTGAGTCAGTGCAAGGAGGCAGG + Intronic
950487450 3:13281911-13281933 CTGGGGCAGGACAAGGGGGCTGG - Intergenic
951953669 3:28229966-28229988 CTGAATTGGAGCAAGGGAGCCGG - Intergenic
952738199 3:36710840-36710862 CTGAGTTGAAGCAAGGGGACTGG + Intergenic
953061731 3:39433573-39433595 CAGGGCTAGGGCAAGTGGGCTGG - Intergenic
954004092 3:47578488-47578510 GTGAGCTGTGGCAAGGGGGCGGG - Intronic
954637710 3:52080323-52080345 CTGAGTTTGGGCATCAGGGCTGG - Intronic
955366863 3:58318228-58318250 CTTAGTTAGGGGAAGGGAGCAGG + Exonic
956165785 3:66397256-66397278 CTCAGTTGGGGCAGGGAGGCTGG - Intronic
957071475 3:75570984-75571006 CAGAGTTAGGACAAGAGGCCCGG - Intergenic
958191007 3:90185095-90185117 CTGACTTAAGGCAAGGGAACTGG - Intergenic
958880182 3:99660512-99660534 CTGTGGTGGTGCAAGGGGGCTGG + Intronic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
959151972 3:102618645-102618667 CTGAGTTGAAGCAAAGGGGCTGG - Intergenic
959599129 3:108159366-108159388 CTGACCAGGGGCAAGGGGGCGGG - Intergenic
960845318 3:121999571-121999593 TTGAGTTAGGGCAAGGGAAGAGG - Intronic
960897071 3:122516099-122516121 TTGAGTTTGAGCAAGGGGGCTGG + Intergenic
960944848 3:122958791-122958813 CTGGGAGAGGGCAAGGGGGTGGG - Intronic
961393799 3:126572080-126572102 ATGAGATAGGGCATGGAGGCCGG - Intronic
963248287 3:143082907-143082929 CTGAGGTGGGGGAAGGGGGGTGG - Intergenic
965734856 3:171809827-171809849 CGGAGGTGGGGCGAGGGGGCCGG - Intronic
966549471 3:181188082-181188104 ATGGGTTAGGACAAGGGGGCCGG + Intergenic
966986003 3:185180999-185181021 CTAAATTAAGGCAAGGGGGATGG - Intergenic
967659103 3:192083555-192083577 CTGACATATGTCAAGGGGGCTGG + Intergenic
968443498 4:636390-636412 CTGAGAGAGGGTACGGGGGCAGG + Intronic
968869616 4:3235039-3235061 CTGAGTTAGGCCGAGAGGGCAGG + Intronic
968939830 4:3631993-3632015 CTGAAGAAAGGCAAGGGGGCTGG - Intergenic
969393433 4:6906126-6906148 CTGAGCTGGGGCAAGGGGATTGG + Intergenic
969517247 4:7654610-7654632 CTGAGTCAGGGCCTGGGGTCGGG - Intronic
969798051 4:9541222-9541244 CAGAGTTAGGACAAGAGGGCTGG + Intergenic
970609203 4:17709665-17709687 CCCAGTTAGGGTGAGGGGGCTGG + Intronic
971258281 4:25032780-25032802 CTGAGTGAGAGCCTGGGGGCAGG + Intergenic
974024657 4:56722868-56722890 CAGAGTTACGTCAAGGGGGCAGG - Intergenic
974072924 4:57141416-57141438 CTGACTTTGGGTAAGAGGGCGGG - Intergenic
974287475 4:59887912-59887934 GTGAGCTAAGGCAAGGAGGCCGG - Intergenic
974956391 4:68646167-68646189 CTGAGGAAGTGCAAGGGGTCAGG - Intronic
976771891 4:88662157-88662179 CTGAGTTGAGGCAAGCGGGCTGG + Intronic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
979994454 4:127413843-127413865 CTAAGTAAGGGCACCGGGGCAGG - Intergenic
981136728 4:141219614-141219636 TTGAGTTAGGGGAACTGGGCTGG - Intergenic
984002839 4:174271557-174271579 CTGAGTGAGGGAAAGGGGTTGGG - Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
987171545 5:15264163-15264185 CTGACTTAAGGCCAAGGGGCAGG + Intergenic
987934382 5:24445400-24445422 CTCAGTTAGGGAGAAGGGGCTGG - Intergenic
988798324 5:34673306-34673328 CTGTGTGAGGGCAATGGGGCAGG + Intronic
992175894 5:74148383-74148405 CAGAGTCAGGGCAAAGGGTCTGG + Intergenic
992212747 5:74496750-74496772 CTGAGGCAGGGCATGGGGGTGGG - Intergenic
992623562 5:78616856-78616878 CTTAATTAGGGCAGGTGGGCTGG - Intronic
997234906 5:132267194-132267216 CAGAGTTTGGGCAAGGAGACTGG + Intronic
998372987 5:141672973-141672995 CTGAGTCAGGGCAGGAGGGAGGG - Intronic
998551290 5:143080440-143080462 CTGTGTTAGGCCAAGTGGTCAGG + Intronic
999296798 5:150464753-150464775 CTGAGTGAGGACAAAGGAGCTGG + Intergenic
1000426610 5:161098447-161098469 ATGAGTGTGGGCATGGGGGCAGG - Intergenic
1001140274 5:169138317-169138339 CTCACTTGAGGCAAGGGGGCAGG - Intronic
1001433462 5:171681609-171681631 TGGAGTGAGGGCATGGGGGCTGG + Intergenic
1001449968 5:171817133-171817155 CTGATTTGAGGCAAGGAGGCTGG - Intergenic
1001542048 5:172546412-172546434 GTGAGCGAGGGCAGGGGGGCAGG + Intergenic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1005990118 6:30897293-30897315 CTGAGGTGGGGCAGGGGGGTGGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1008480950 6:51984068-51984090 CTGAGTTATGACAAAGGGGCAGG + Intronic
1008941432 6:57050012-57050034 ATGAGGTAGGGCCAGGGGGTGGG + Intronic
1009339582 6:62537207-62537229 CTGAGTTAGGGCATAGGGCTAGG - Intergenic
1010463284 6:76138041-76138063 GTGAGGTAGGGGAAGGGGGGAGG - Intergenic
1012398725 6:98827684-98827706 CTGAGCAAGGGAAGGGGGGCCGG - Intergenic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1012924308 6:105252170-105252192 TTGAGTTAGGGGAAGGGGTAGGG + Intergenic
1017029673 6:150210191-150210213 GCAAGTTGGGGCAAGGGGGCTGG + Intronic
1017618396 6:156269724-156269746 CAGAGGTAGGGCAAGGTGGAAGG - Intergenic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1020492593 7:8806866-8806888 ATGAGTTAGGGAGAGGGGGCGGG - Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1024482129 7:49874829-49874851 CTGAATTAGGGAAGAGGGGCAGG - Intronic
1025597457 7:62949256-62949278 GTGGGGTAGGGGAAGGGGGCAGG - Intergenic
1026000838 7:66558169-66558191 CTGAGTTGGGGTGGGGGGGCAGG - Intergenic
1026773287 7:73215389-73215411 CTGACGTAGGGCAGGGCGGCGGG + Intergenic
1027014147 7:74768785-74768807 CTGACGTAGGGCAGGGCGGCGGG + Intergenic
1027073887 7:75177247-75177269 CTGACGTAGGGCAGGGCGGCGGG - Intergenic
1029140721 7:98407926-98407948 CTGGGTTGGGGTAGGGGGGCAGG - Intergenic
1031370745 7:120962549-120962571 GTGAGTTAGGGCAAGGTGTATGG + Intronic
1031580510 7:123468558-123468580 CTGAATTTAGGCAAGGGGCCAGG - Intronic
1035485960 7:159226296-159226318 CTGCCTTAGGGCAACAGGGCAGG + Intergenic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1036303775 8:7585792-7585814 CCAAGTTGGGTCAAGGGGGCTGG - Intergenic
1036354630 8:8033784-8033806 CCCAGTTGGGTCAAGGGGGCTGG - Intergenic
1036360634 8:8074422-8074444 CAGAGTTAGGACAAGAGGGTCGG + Intergenic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1036890336 8:12592544-12592566 CAGAGTTAGGACAAGAGGGTTGG - Intergenic
1037876491 8:22551420-22551442 CGGAGCCAGGACAAGGGGGCAGG - Intronic
1039474294 8:37831357-37831379 CTGAGGGAGGGCAACGTGGCTGG + Intronic
1039901151 8:41753421-41753443 CTGACTGAGGGGAAGGGGTCTGG - Intronic
1039992184 8:42497800-42497822 CTGAGGTTGGGCACGGGGGGAGG + Intronic
1040577642 8:48667685-48667707 ATTAGTAAGGGGAAGGGGGCTGG - Intergenic
1041568977 8:59314321-59314343 TTGACTTAGGGCAAGGAGCCTGG - Intergenic
1041758442 8:61338775-61338797 CTGAGCCAGAGCCAGGGGGCAGG - Intronic
1042178563 8:66061521-66061543 CTCAGCTAGGGCACGGGTGCAGG + Intronic
1044499772 8:92939910-92939932 CTGTGGTTGGGCAAGGGTGCAGG - Intronic
1045105137 8:98885219-98885241 CTGTGCTGGGGCAAGGAGGCAGG - Intronic
1046585261 8:116142619-116142641 CTGGGCTAGGGAAAGGGGTCTGG + Intergenic
1047015608 8:120720079-120720101 ATGGGTTAGGGCAAAGGGGCTGG + Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049378094 8:142298533-142298555 CTGAGTGAGCGCCAGGAGGCTGG + Intronic
1049476745 8:142800398-142800420 CTGAGAAAGGGCAGTGGGGCTGG - Intergenic
1052220880 9:26020257-26020279 CTGGGTTAGGGCAATCTGGCAGG - Intergenic
1052947420 9:34179279-34179301 CGGAGTTGGGGGAGGGGGGCTGG + Intronic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053419629 9:37969235-37969257 CTGGGTTAGGGCAGGGGCTCTGG + Intronic
1054450930 9:65403317-65403339 CTGAAGAAAGGCAAGGGGGCTGG + Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1057805593 9:98217432-98217454 CTGAGCTGGGGCAAGGGAGAAGG - Intronic
1059249838 9:112878586-112878608 CTGACTCAGTGCAAGGGTGCTGG + Intronic
1059432800 9:114260115-114260137 CTGAGGCAGGGCAGGGGGCCTGG - Intronic
1060698603 9:125731282-125731304 CTGAGTTAAGCCAAGACGGCTGG - Intergenic
1061154623 9:128850365-128850387 CAAAGTTAGGGCAAAGTGGCTGG - Intronic
1062291504 9:135797316-135797338 CTGAGTGAGGGCAGGGGCCCAGG - Intergenic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1186553769 X:10535201-10535223 CTGAGTGAGGTCCAGGGAGCAGG + Intronic
1187722446 X:22165435-22165457 CTGAATTGAGGCAAGGGGGCTGG + Intronic
1189131071 X:38498604-38498626 CTCAGTTGGGCCAAGGTGGCTGG - Intronic
1189203495 X:39217973-39217995 CAGAGATAGGCCAAGGGGACAGG - Intergenic
1189366807 X:40395157-40395179 CCCAGTTGAGGCAAGGGGGCCGG + Intergenic
1189544671 X:42029236-42029258 CAGACTTAAGGCAAGGGAGCTGG - Intergenic
1189552501 X:42107731-42107753 CTGAGTTTCTGCAAGGTGGCAGG + Intergenic
1189682273 X:43529123-43529145 CCAAGTTGGGGCAAGGGGACTGG - Intergenic
1190287668 X:48971652-48971674 ATGGGTTAGGGCGTGGGGGCTGG + Intergenic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1191154762 X:57261307-57261329 CTTTGTTAGGGCAAGGCGGGTGG + Intergenic
1192222503 X:69207043-69207065 CTGAGTGAGGGCCAGGGTGAGGG + Intergenic
1193544410 X:82808727-82808749 CTCAGGAAGGGCAAGGGGTCAGG - Intergenic
1195397242 X:104424919-104424941 CAGGGTTTGGGAAAGGGGGCTGG - Intergenic
1195427186 X:104747582-104747604 CTGACTTAGGGAAGGGGGACAGG + Intronic
1198323478 X:135543035-135543057 CTGAGTTAGGGCAGTGGGGATGG - Intronic
1198574773 X:137998136-137998158 CTGGGTTTGGGGCAGGGGGCTGG - Intergenic
1198851651 X:140970603-140970625 TGGAGATAGGGAAAGGGGGCAGG + Intergenic
1199100714 X:143796509-143796531 CTGAGTTTGGGCAAGGGTTCTGG + Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic