ID: 1115510245

View in Genome Browser
Species Human (GRCh38)
Location 14:34131215-34131237
Sequence CAGCCACAGCAGCTACAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115510245_1115510248 13 Left 1115510245 14:34131215-34131237 CCCCTTTGTAGCTGCTGTGGCTG 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1115510248 14:34131251-34131273 TGTTTCCAGCTCCACTCCCGTGG 0: 1
1: 0
2: 0
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115510245 Original CRISPR CAGCCACAGCAGCTACAAAG GGG (reversed) Intronic
901213083 1:7537386-7537408 CAGCCCCACCAGCTTCAGAGTGG + Intronic
903761728 1:25703225-25703247 CAGCCTCAGCACCCACAGAGAGG - Intronic
904088206 1:27925908-27925930 CAGTCACTGCTGCTGCAAAGGGG + Intergenic
905008445 1:34730027-34730049 CAGTCACAGGAGCTTCAAAGGGG + Intronic
905479828 1:38254135-38254157 CAGGCACTGCAGAGACAAAGAGG + Intergenic
907492423 1:54816608-54816630 CACCACCAGAAGCTACAAAGAGG - Intronic
910191387 1:84599490-84599512 CAGTCACAGCAGGGAGAAAGTGG + Intergenic
911476506 1:98379975-98379997 CAGAGACACGAGCTACAAAGTGG + Intergenic
912412624 1:109489017-109489039 CAGCCACCGCTGCTACAACCTGG - Exonic
912723494 1:112039663-112039685 CACACTCAGCAGCTACAGAGAGG - Intergenic
913063760 1:115231170-115231192 CAGCAACAGCAGCAAGGAAGGGG + Intergenic
915261083 1:154677524-154677546 CTGCCACAGGACCTAGAAAGGGG - Intergenic
915436470 1:155910721-155910743 CTGCTACAGCAGCTACCAACTGG + Exonic
915474415 1:156144963-156144985 CAGCCACGGTAGCTCCAATGGGG - Intergenic
916615393 1:166434066-166434088 CAGCAACAGAAGCTAGCAAGAGG + Intergenic
917445547 1:175103173-175103195 CTGCCACAGGACCTAGAAAGGGG + Intronic
918107166 1:181425170-181425192 CAGCCCCTCCAGCTACACAGCGG - Intronic
920716916 1:208348879-208348901 CAGCCAGGGAAGCTTCAAAGAGG + Intergenic
920910839 1:210214897-210214919 CAGCCACACCCTCTACAATGAGG - Intergenic
922448843 1:225720169-225720191 CTGGCACAGCAGCTACAGATAGG - Intergenic
924159411 1:241215570-241215592 CAGCCAGAGCAGCTGGAAACTGG - Intronic
1064126921 10:12670448-12670470 CAGCAACACAAGCTACAAAATGG - Intronic
1064197636 10:13259088-13259110 CTGCCACAGGACCTAGAAAGGGG - Intergenic
1064251608 10:13710447-13710469 CAGCTACAGCAGCCACAGACGGG - Intronic
1064447478 10:15408427-15408449 CACCCTCAGCAGCTAGAATGGGG - Intergenic
1066491234 10:35897384-35897406 CACCCACACCAGCTGCAAAAGGG + Intergenic
1068522194 10:58089818-58089840 CAGCCAGACCAACTGCAAAGTGG - Intergenic
1069371048 10:67747560-67747582 CAGCAACAGCATCAACAAAAAGG + Intergenic
1070817912 10:79336693-79336715 CAGCCACAGGAGCAGCACAGGGG + Intergenic
1070871610 10:79758817-79758839 CATCCAGAGCAGCAACACAGTGG + Intergenic
1071573368 10:86709956-86709978 CACCCACACCAGCTACAGTGAGG + Exonic
1071691633 10:87826160-87826182 CAGCAACAACAACAACAAAGGGG + Intronic
1071835275 10:89411881-89411903 CTGCCACAGGACCTAGAAAGGGG - Intronic
1073469225 10:103712534-103712556 CAGCCTCAGGAGCTCCAAGGAGG - Intronic
1075292929 10:121245743-121245765 CACACGCAACAGCTACAAAGGGG + Intergenic
1075472425 10:122701781-122701803 CTGCCACAGCAGGTACAGACAGG + Intergenic
1076064809 10:127440746-127440768 CAGCCACAGCACCTACCCACAGG - Intronic
1076301089 10:129426878-129426900 CACTCAGAGCAGCTGCAAAGAGG - Intergenic
1076615673 10:131752585-131752607 CTGCCACAGCAGAGACCAAGTGG + Intergenic
1076695410 10:132244892-132244914 CAGCCTCACCAGCAACAAAACGG + Intronic
1076868476 10:133181235-133181257 CACCCACAGCAGCATCAGAGCGG + Intronic
1079159643 11:17979894-17979916 CAGACACAGCCGCTAAAAAATGG + Intronic
1081129049 11:39354300-39354322 CATCCACATCAGCTTGAAAGTGG + Intergenic
1081683679 11:45026526-45026548 CAGTCACAGCAGCAACACAGTGG + Intergenic
1081744633 11:45464285-45464307 CAGCCACAGGAGCCAGAGAGAGG + Intergenic
1083031838 11:59599697-59599719 TAGCCACAGCAGAAAAAAAGTGG + Intronic
1083198033 11:61102589-61102611 CATCCCCAGCAGGTACAAGGTGG - Exonic
1083407203 11:62465817-62465839 GAGCACCAGCAGCTAGAAAGAGG + Intronic
1084402166 11:68950925-68950947 CATCCACCGCTGCTACAATGAGG - Intergenic
1084765084 11:71303029-71303051 CAACCACAGCAGCAATAAATTGG - Intergenic
1085226412 11:74925024-74925046 TAGCCAAAGCAGCTAGAATGAGG - Intronic
1087160200 11:94941158-94941180 CAACCACAGCAGTCACCAAGAGG + Intergenic
1088564572 11:111155205-111155227 AACCAACAGAAGCTACAAAGAGG - Intergenic
1089130704 11:116209741-116209763 AAGCCACAGCTGCTACAGGGAGG - Intergenic
1089758665 11:120706783-120706805 CTGGGACAGCAGCTACAGAGGGG - Intronic
1091329937 11:134724503-134724525 CAGCCTCCGCAGCTGCACAGGGG + Intergenic
1092116374 12:6011576-6011598 CAGCCAGGGCAGCGTCAAAGGGG - Intronic
1092119382 12:6033538-6033560 CAGCCTCAGCAGCAAAAGAGAGG - Intronic
1093881249 12:24406506-24406528 CAGCAACAGCAACTAGGAAGTGG + Intergenic
1094356472 12:29583466-29583488 AAGCAACAGCAGCAACACAGTGG + Exonic
1094365259 12:29673005-29673027 GAGCCACAAGAGCTAGAAAGTGG + Intronic
1095548473 12:43402170-43402192 CACCCATATCACCTACAAAGTGG + Intronic
1096030695 12:48411459-48411481 GAGCCACAGCAGCTTCAAACTGG - Intergenic
1096041876 12:48524360-48524382 CATCCACAGTAACTGCAAAGTGG + Intronic
1098509563 12:71295740-71295762 AAGCCACAGCATCTAGAAAATGG + Intronic
1101055735 12:100911529-100911551 CAGAAAGAGAAGCTACAAAGTGG - Intronic
1101691472 12:107086570-107086592 CAGCCAGAGCAGCCAGAACGTGG - Intronic
1103673112 12:122634512-122634534 CAGCCACAGCCCTTACAAAAGGG + Intergenic
1105763016 13:23531049-23531071 CTGCCACAGGACCTAGAAAGGGG - Intergenic
1105972448 13:25442165-25442187 TATTCACAGCAGCTACAACGTGG - Intronic
1106810755 13:33356573-33356595 CAGCCTCAGCATCTATAAAATGG + Intergenic
1107606014 13:42057908-42057930 AAGGAACAGCAGCTGCAAAGAGG + Intronic
1109295739 13:60528378-60528400 CAGCCACAGCAGCTTCATCAGGG + Exonic
1112094762 13:96120183-96120205 CAGCCCCAGAAGCTAGGAAGAGG + Intronic
1112519677 13:100084484-100084506 CTGCCACAGGACCTAGAAAGGGG - Intergenic
1113853733 13:113432766-113432788 CAGTCACAGCAGATACCAAAAGG + Intronic
1115510245 14:34131215-34131237 CAGCCACAGCAGCTACAAAGGGG - Intronic
1117649976 14:57893677-57893699 CAGCCATACCAGCAACAGAGGGG + Intronic
1121011036 14:90520527-90520549 CATCCGCAGCAGCTCCCAAGGGG + Intergenic
1122057763 14:99116471-99116493 CAGCTGCAGCAGCTAAAATGTGG + Intergenic
1122253150 14:100454759-100454781 TAACCACAGCAGCTGGAAAGTGG + Intronic
1122268384 14:100557210-100557232 CAGCCACAGAACCTACAGAGAGG + Intronic
1122383440 14:101327154-101327176 CAGCCAAAGCAGGAAGAAAGAGG - Intergenic
1122471428 14:101969538-101969560 CAGCTCCAGCAGACACAAAGAGG + Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1126864488 15:52922325-52922347 GAGCCACAGCAGATACAAAGAGG + Intergenic
1127975063 15:63990965-63990987 CAGCCACAGAGGCTCCACAGTGG - Intronic
1128145550 15:65330677-65330699 CTCCCACAGCAGCTGCAAGGAGG + Exonic
1129323044 15:74785363-74785385 CAACCACAACAGCAACAGAGGGG - Intronic
1129458575 15:75688698-75688720 CAGCCGCAGCATCCACACAGTGG + Exonic
1129772645 15:78212684-78212706 GAGCCACAGCAGCCCCAGAGAGG + Intronic
1130047828 15:80459967-80459989 CAGCCACAGTCACTGCAAAGTGG - Intronic
1130411636 15:83653533-83653555 CAGGCCCAGCAGCCACACAGAGG - Intergenic
1130899709 15:88198180-88198202 CAGCCACTGAAGCTACAAGTAGG - Intronic
1131121439 15:89825411-89825433 CATCCACAGCAGCTTGAAATTGG - Intergenic
1132319763 15:100917703-100917725 CAGCCACTGCACCTTCAAAAAGG + Intergenic
1132548774 16:545656-545678 CAGCCTCACCAGCTCCAGAGAGG - Intronic
1135339088 16:21630817-21630839 CTGCCACAGGACCTAGAAAGGGG + Intronic
1135840331 16:25870251-25870273 TATCCACAGCACCTAGAAAGGGG - Intronic
1135847597 16:25932791-25932813 CAGGCAAAGCAGCTCCTAAGTGG + Intronic
1135879423 16:26239959-26239981 CACCCACAGCAGCAACAGCGTGG + Intergenic
1136228404 16:28873558-28873580 CAGCCGCAGCAGCCAAAGAGAGG + Exonic
1136361837 16:29785626-29785648 CATGCACAGCCGCTACAAACGGG + Intergenic
1136401756 16:30023119-30023141 CAGCCCCAGCATTTACAAAGAGG - Intronic
1138441460 16:57037429-57037451 TATCCACAGCAGCTAGGAAGAGG - Intronic
1141382126 16:83586003-83586025 CAACCACAGCAACTTCACAGGGG + Intronic
1141950431 16:87335891-87335913 GTGCCACAGCAGCTACAGGGAGG + Intronic
1142994849 17:3754581-3754603 CAGGCACAGCAGCCACCCAGGGG - Intronic
1143081719 17:4386447-4386469 TAGCCACTGCAGCTCAAAAGTGG - Intergenic
1146137800 17:30338315-30338337 CAGCAGCAGCAGCTACACACTGG - Intergenic
1146954770 17:36931137-36931159 CAGCCAACTCAGCTACCAAGGGG + Intergenic
1147162537 17:38576530-38576552 CGGTCACAGCAGATACAAAGTGG - Intronic
1149539897 17:57460992-57461014 CCACCAAAGCACCTACAAAGAGG - Intronic
1151554559 17:74840133-74840155 CAGCTACAGCAGCAACAGAAGGG + Intergenic
1157401270 18:47390514-47390536 CAGCCACAGCAGGGAGAAGGAGG + Intergenic
1157836481 18:50908525-50908547 CAGCCACTGAGGCTATAAAGTGG + Intronic
1160015230 18:75135147-75135169 CCCCCACAGCAGCCACAGAGTGG + Intergenic
1160434946 18:78843310-78843332 CAGCCAAAGCAGTGATAAAGGGG - Intergenic
1160730017 19:637482-637504 CAACCACAGAGGCTACAAAGAGG + Intergenic
1160910956 19:1473609-1473631 CAGCCACAGCAGCCACTACCGGG + Exonic
1161309636 19:3586506-3586528 CACCCTCAACAGCCACAAAGTGG + Exonic
1162593226 19:11606805-11606827 AAGCCACAGCAGCTGCCATGTGG - Intronic
1162784317 19:13024774-13024796 CAGCCTCAGCAGCCAGACAGAGG - Intronic
1163976351 19:20856729-20856751 CATTCACAGCTGCTACAAAGAGG + Intronic
1164581466 19:29438011-29438033 AAGCCCCATCACCTACAAAGGGG - Intergenic
1164812004 19:31164783-31164805 CCACCGCAGCAGCCACAAAGGGG - Intergenic
1165471974 19:36009229-36009251 GAGTCACAGCAGCCCCAAAGGGG + Exonic
1165867899 19:38950131-38950153 CAGCTGCAGCAGCCACACAGTGG + Exonic
1166691420 19:44823383-44823405 CAGTCACCTCAGCCACAAAGTGG + Intergenic
1167553663 19:50178882-50178904 CTGGCACAGCAGCTGCACAGCGG + Intergenic
925689523 2:6506776-6506798 CTGCCACACCAGCTACTGAGTGG + Intergenic
925989772 2:9245284-9245306 CAGCCACGGCAGCAACACACTGG - Intronic
927216914 2:20672548-20672570 CAGCGAAAGCAGGTAAAAAGCGG - Exonic
927912816 2:26913535-26913557 CATTCACAGCAGCTAAAAGGTGG - Intronic
929789373 2:45012268-45012290 CAGCTACTGCTGCTACCAAGAGG - Intergenic
929957223 2:46467296-46467318 CAGCCATACCATCTCCAAAGAGG + Intronic
930100375 2:47598712-47598734 CTCCCCCAGCAGCTGCAAAGGGG - Intergenic
930257692 2:49110787-49110809 CAGCCCCAGCAGGAACAAGGGGG - Intronic
931122519 2:59235678-59235700 CAACCACAGAAGCTAGGAAGAGG - Intergenic
931197151 2:60063553-60063575 CAGCCACTGCAGATACAGAGAGG + Intergenic
931462260 2:62459260-62459282 CAGCAGCTGCAGCTGCAAAGAGG + Intergenic
932437969 2:71714158-71714180 CATCCACACCAGCTACACTGAGG - Intergenic
932697523 2:73969158-73969180 CAGGCACTGGAGATACAAAGTGG - Intergenic
932880126 2:75493439-75493461 CAGCGACAGCAGCGACAGCGAGG - Exonic
934523235 2:95032968-95032990 CAGCCACAGCACCTCCGCAGCGG + Intronic
934707627 2:96495651-96495673 CAGAAACAGCAGCAACAAACTGG - Intergenic
936039516 2:109139477-109139499 CAGCCACAGAAGGCACAAGGGGG - Intronic
936251106 2:110869104-110869126 CAGACACTTCAGCTACAAAGAGG - Intronic
938131985 2:128724580-128724602 CAGACACAGGTGCTATAAAGGGG + Intergenic
938153273 2:128904354-128904376 CTGCCACAGGACCTAGAAAGGGG + Intergenic
938695960 2:133835788-133835810 AAGCTACAGGAGCTACACAGAGG + Intergenic
939852507 2:147318380-147318402 CTGCCACAGGACCTAGAAAGGGG - Intergenic
942558706 2:177198457-177198479 CAGCCACAGCAGCTCCACCAGGG + Intergenic
943366521 2:186972216-186972238 CAGCCTCAGCAACCAGAAAGTGG + Intergenic
944729500 2:202502876-202502898 CTGCCACAGGACCTAGAAAGGGG - Intronic
1168861140 20:1046760-1046782 CAGCCTCAGCATCAACAATGGGG + Intergenic
1169021801 20:2335991-2336013 CAGCAACAGCATCTTCAAAGTGG + Intronic
1169105087 20:2987741-2987763 CAGCCACACCAGGTAGAGAGAGG - Intronic
1169332295 20:4725464-4725486 CAGCATCACCAGCTAGAAAGTGG + Exonic
1169681623 20:8220622-8220644 GAGCCACAGAAGCTAGGAAGAGG + Intronic
1170440806 20:16377188-16377210 CACCCACAGCACCTCCTAAGGGG - Intronic
1172006723 20:31823133-31823155 CAAACACAGCAGCTATAAAGCGG - Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172223194 20:33287575-33287597 CAACCACACCCTCTACAAAGAGG - Intronic
1172340950 20:34157204-34157226 CTGCCACAGGACCTAGAAAGGGG - Intergenic
1174120673 20:48262924-48262946 CAACCACAGGAGTTATAAAGAGG + Intergenic
1174940467 20:54920895-54920917 CATCCCAGGCAGCTACAAAGAGG + Intergenic
1176084311 20:63289119-63289141 CCTCCACACCAGCTACCAAGAGG - Exonic
1177438716 21:21089967-21089989 CAGCCACACCAACAACAAATAGG + Intronic
1177807673 21:25889906-25889928 CAACAACAGCAGCAAAAAAGGGG + Intronic
1178109459 21:29355771-29355793 CTGCCACAGGACCTAGAAAGGGG + Intronic
1178716331 21:34967910-34967932 CAGCCACAGCACCTACATTAAGG - Intronic
1179006991 21:37523835-37523857 CTGCCACAGTAGCACCAAAGTGG - Intergenic
1179655192 21:42840104-42840126 CAGGCACAGCAGGTACACAGGGG - Intergenic
1180567792 22:16690062-16690084 CAGCCAGGGCAGCGTCAAAGGGG - Intergenic
1181058781 22:20272213-20272235 AAGCCACAGCAGCAGCAAAGGGG + Intronic
1181725695 22:24809491-24809513 GAGCCACTGCAGCCACGAAGGGG + Intronic
1183079852 22:35449416-35449438 AAGCCACAGCAGGGACAGAGAGG - Intergenic
1183720965 22:39561111-39561133 CAGGCACAGCAGCTCCAAAAGGG - Intergenic
1184921970 22:47612425-47612447 CAGGCACAGCAGGTAGAAAGAGG + Intergenic
1184970327 22:48015381-48015403 ACGCCACAGCAGCTACACACTGG - Intergenic
952741154 3:36736331-36736353 CACTCACAGCAGCCACAAAGGGG + Intronic
953469768 3:43156760-43156782 CAGCAACAACAGCCCCAAAGTGG + Intergenic
954750133 3:52808857-52808879 GACCCACAGCAGCTCAAAAGAGG + Exonic
957935909 3:86942308-86942330 GAGCCATTGCAGTTACAAAGGGG - Exonic
958073240 3:88641516-88641538 CAGCCACATCCTCTTCAAAGAGG + Intergenic
959540220 3:107528396-107528418 CTGCCACAGTACCTCCAAAGAGG - Intronic
960044959 3:113187625-113187647 CTGTCACAGCAGCTACAGTGGGG - Intergenic
962331355 3:134481524-134481546 CAGCCACATCATATACGAAGTGG - Intronic
962365176 3:134774172-134774194 GAGCCACATCAGCCACATAGGGG - Intronic
963021671 3:140878041-140878063 CTGCCACAGGACCTAGAAAGGGG - Intergenic
963325229 3:143855332-143855354 CAGAGACAGCAGCCAGAAAGAGG + Intergenic
963546026 3:146659122-146659144 CTGCCACCCCAGCTACACAGGGG + Intergenic
968542878 4:1177272-1177294 CAACCACAGCAGGCACTAAGGGG - Intronic
968726942 4:2252206-2252228 CAGCAACAGGAGCTGCCAAGGGG - Intronic
971280667 4:25240105-25240127 CTGCCACAGGACCTAGAAAGGGG + Intronic
971445350 4:26740693-26740715 TACCCACAGCAGGTCCAAAGGGG - Intronic
973937773 4:55866716-55866738 CAGCCAAATCAACTACCAAGTGG - Intronic
974969575 4:68807485-68807507 TAGCCACAGCTGAGACAAAGGGG - Intergenic
975013563 4:69383461-69383483 CAGCCACAGCTGAGACACAGGGG - Intronic
975640889 4:76499232-76499254 TAGCCACAGCAGCTAGGAAGTGG - Intronic
976183956 4:82427243-82427265 CAGCAACAGCAACAACAAAAAGG - Exonic
976555789 4:86449957-86449979 CAGTCACAGGAGCTTGAAAGAGG + Intronic
976931007 4:90567235-90567257 CAGCAACAGCAGTTCAAAAGGGG - Intronic
977640709 4:99355374-99355396 CAGCCACGGGACCTAGAAAGGGG - Intergenic
978928376 4:114279279-114279301 CAGCCACATCAGCAACACCGAGG + Intergenic
979031303 4:115651640-115651662 CAGCACCAGAAGCTAGAAAGAGG - Intergenic
980710722 4:136563842-136563864 CAGCAACATCAGCTGAAAAGTGG + Intergenic
983684316 4:170389669-170389691 CAGCCAGAGCTGCTGCCAAGTGG + Intergenic
986128810 5:4908580-4908602 CAGCCACAGAAGCCACTATGAGG + Intergenic
990063347 5:51680240-51680262 CAGCTTCAGCATCTATAAAGTGG + Intergenic
990521873 5:56588769-56588791 CAGCCCCAGCAGCTACATCCTGG - Intronic
991179821 5:63736970-63736992 CAGCCACAGCAGTTGCTAAGGGG + Intergenic
993499318 5:88647045-88647067 CAGCCACAGTTGCTCCAAGGTGG + Intergenic
994820334 5:104642351-104642373 CAGCCATAGCATCTATAAAGGGG - Intergenic
995707275 5:114998844-114998866 CTGCCACAGGACCTAGAAAGGGG - Intergenic
996217942 5:120891899-120891921 CAGCCACAGCTGTTTCCAAGGGG - Intergenic
997385361 5:133468107-133468129 CAGCAAGAGGAGCTACAAACAGG - Intronic
998216369 5:140241048-140241070 TAGAAACAGCAGCTACAAAATGG - Intronic
998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG + Intronic
998254806 5:140576590-140576612 AAGGCAGAGCAGCTACACAGAGG + Intronic
998856251 5:146398030-146398052 CAGCCACATCAGCATAAAAGTGG + Intergenic
999444308 5:151627096-151627118 CAGCTACAGCAGCTACACACAGG - Intergenic
1002335553 5:178475746-178475768 CAGCCACAAAAGCTTGAAAGAGG - Intronic
1003019554 6:2497667-2497689 CAGCCCCACCAGCCACAAGGTGG - Intergenic
1003732625 6:8843002-8843024 CAGATATAGCAGCTACAAAATGG - Intergenic
1004746978 6:18520012-18520034 ATGGCACAGCAGCTACACAGAGG - Intergenic
1006761836 6:36469323-36469345 ATGCCACAGCAGCCACACAGGGG - Intronic
1006802632 6:36768943-36768965 CTTGCACAGCAGCTCCAAAGTGG - Intronic
1009730972 6:67606024-67606046 CAGCAACAACAACAACAAAGTGG + Intergenic
1009739146 6:67722538-67722560 CTGCCACAGGACCTAGAAAGGGG - Intergenic
1010338458 6:74718779-74718801 CAGCAAAAGCAGCTATGAAGTGG - Intergenic
1010367985 6:75074841-75074863 CTCCCAAAGCAGCTAAAAAGTGG + Intergenic
1011461237 6:87606690-87606712 CAGCTACATCAGCTACATTGTGG + Intronic
1012851372 6:104449962-104449984 CAGCCACAAGATCAACAAAGAGG + Intergenic
1013576075 6:111483932-111483954 CAGACACTGCAGCAGCAAAGAGG - Intergenic
1013804770 6:113985045-113985067 CAGCAACAGCAGCAGCAAATGGG - Intronic
1014149151 6:118033722-118033744 CAGCCACAGCAGCAAGAAGAGGG + Intronic
1014859721 6:126450755-126450777 CAGCCACTAAAACTACAAAGTGG - Intergenic
1015202101 6:130594296-130594318 CATCCACATCTGCTACTAAGAGG + Intergenic
1015455889 6:133425668-133425690 CAGTCATAGCGGCAACAAAGTGG - Intronic
1017624784 6:156337518-156337540 CAGCAACAGGAGCTAGAATGAGG - Intergenic
1017647460 6:156552140-156552162 CCACCACAGCAGCTGGAAAGAGG + Intergenic
1017817451 6:158026290-158026312 CAGGCACTGTAGCTAGAAAGTGG + Intronic
1019303301 7:320321-320343 CACTCACAACAGCCACAAAGTGG + Intergenic
1019440239 7:1042290-1042312 CACCCTCAGCAGCCACACAGGGG + Intronic
1019504349 7:1383397-1383419 CACCCAGAGCAGCCAGAAAGTGG + Intergenic
1019725893 7:2602536-2602558 CACCCACAGCTGCTTCTAAGTGG + Intronic
1022445109 7:30464019-30464041 CAGCTTCTGCAGCTCCAAAGAGG - Intronic
1022844737 7:34198608-34198630 CAGTCACAGCAGTGGCAAAGCGG + Intergenic
1023247656 7:38222754-38222776 CAAACAAAGCAGCTACACAGTGG - Intronic
1024573963 7:50748686-50748708 CCGCCACAGCAGCTAAACACTGG - Intronic
1026234176 7:68511427-68511449 CAGCCTAAGAAGCGACAAAGTGG + Intergenic
1028477190 7:91265154-91265176 CCGCCTCAGCAGCAACAGAGCGG + Exonic
1029503933 7:100950630-100950652 CAGCCACAGCAGATGGGAAGTGG - Intronic
1030018743 7:105250992-105251014 CAGCAACAGAAGCTACTCAGGGG + Intronic
1030593544 7:111509306-111509328 GGACCACAGCAGCTACAAAAGGG + Intronic
1031531307 7:122879760-122879782 AAACCACAACATCTACAAAGTGG + Intronic
1034579351 7:152028984-152029006 CTGCCACAGGACCTAGAAAGGGG + Intronic
1035014066 7:155748769-155748791 CTGCAGCAGCAGCCACAAAGGGG - Intronic
1035384238 7:158459649-158459671 CAGCCACAGCGGCTGGACAGGGG - Intronic
1035603451 8:912944-912966 CAGCAACTGCAGCTACTGAGGGG - Intergenic
1040667356 8:49650489-49650511 CTGCCACAGGACCTAGAAAGGGG + Intergenic
1042401955 8:68360070-68360092 AAGCCACAGCTGAAACAAAGAGG - Intronic
1044399127 8:91750006-91750028 CAGCCACACTAGATACAAAGGGG - Intergenic
1045132087 8:99164271-99164293 CTGCCACAGGACCTAGAAAGGGG + Intronic
1046847219 8:118931160-118931182 CAGCAACAGCAACAACAAAACGG + Intronic
1047116264 8:121844682-121844704 AACACAGAGCAGCTACAAAGAGG + Intergenic
1047508542 8:125498455-125498477 CAGAGACAGCAGCTACAGGGTGG - Intergenic
1048757642 8:137755990-137756012 CTGCCACAGGACCTAGAAAGGGG + Intergenic
1049696221 8:143985518-143985540 CAGCAACAGCAGGTCCACAGAGG + Exonic
1050331316 9:4549282-4549304 CAGCCACAGCAGACACCAGGAGG - Intronic
1050932490 9:11348175-11348197 CAGCCACAGCATCTGCATAATGG + Intergenic
1051935724 9:22440526-22440548 CTGCCACAGGACCTAGAAAGGGG - Intergenic
1056706141 9:88954033-88954055 CAGCCACAACAGCTGCAACCTGG + Intergenic
1057131212 9:92655838-92655860 CACCCACAGCAGCTGCAGAAGGG + Intronic
1058941088 9:109813229-109813251 AAGCCTCAGCAGCCACACAGTGG - Intronic
1059808052 9:117826158-117826180 CAGCCACAGTCACCACAAAGAGG - Intergenic
1060658318 9:125388008-125388030 CAGAGGCAGCAGCTACACAGAGG - Intergenic
1061599458 9:131657634-131657656 CAGCCACAGCAGCCACAATCAGG - Intronic
1062081767 9:134627901-134627923 CAGACCCACCAGCTTCAAAGCGG + Intergenic
1062673664 9:137726543-137726565 CAACCACAGCAGCCAAAAGGGGG - Intronic
1062675145 9:137738610-137738632 CAACCACAGCAGCCAAAAGGGGG + Intronic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1187890114 X:23926408-23926430 CATTCTCAGCAGCTAAAAAGTGG - Intronic
1188098079 X:26046885-26046907 CTGCCACAGGACCTAGAAAGGGG - Intergenic
1189393446 X:40598264-40598286 CATCCACAGCAAATAAAAAGGGG - Intronic
1196375710 X:115030500-115030522 CAGCCACATCACCTCCAAAAAGG - Intergenic
1198090023 X:133319494-133319516 CAGCCACCTCGTCTACAAAGAGG - Intronic
1198675831 X:139129044-139129066 CAGCCAGAGTAGCTGCACAGAGG - Intronic
1201488019 Y:14512302-14512324 CTGCCACAGGACCTAGAAAGGGG - Intergenic
1201495837 Y:14590658-14590680 CTGCCACAGGACCTAGAAAGGGG + Intronic
1201556202 Y:15266788-15266810 CTGCCACAGGAACTAGAAAGGGG - Intergenic
1201572891 Y:15433331-15433353 CTGCCACAGAACCTAGAAAGGGG - Intergenic
1201743628 Y:17348396-17348418 CTGCCACAGGACCTAGAAAGGGG + Intergenic
1202243642 Y:22794543-22794565 CTGCCACAGGACCTAGAAAGCGG - Intergenic
1202396629 Y:24428293-24428315 CTGCCACAGGACCTAGAAAGCGG - Intergenic
1202474154 Y:25241799-25241821 CTGCCACAGGACCTAGAAAGCGG + Intergenic