ID: 1115514288

View in Genome Browser
Species Human (GRCh38)
Location 14:34169740-34169762
Sequence GTACAGCAAAGGCCAAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115514288_1115514291 -1 Left 1115514288 14:34169740-34169762 CCATACTTTGGCCTTTGCTGTAC 0: 1
1: 0
2: 1
3: 13
4: 153
Right 1115514291 14:34169762-34169784 CCACATCTAGCTGCATTATTTGG 0: 1
1: 0
2: 0
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115514288 Original CRISPR GTACAGCAAAGGCCAAAGTA TGG (reversed) Intronic
902209470 1:14894277-14894299 GAACAGCAAATGGCAAAGCAGGG - Intronic
904362256 1:29983861-29983883 GTACAGCAAGGGCAAATGAATGG - Intergenic
904718073 1:32484361-32484383 GTACAACAAAGGAAGAAGTATGG + Intronic
905258557 1:36701362-36701384 GTACATAAAAGGTCAAAGAATGG + Intergenic
909150095 1:71991464-71991486 GTACAGCATTAGCCAAAATACGG - Intronic
910935824 1:92484179-92484201 GGACAGCAGAGGCCAGAGAAAGG + Intronic
913674155 1:121125722-121125744 GGACCCCAAATGCCAAAGTAGGG - Intergenic
914025939 1:143913043-143913065 GGACCCCAAATGCCAAAGTAGGG - Intergenic
914664376 1:149820763-149820785 GGACCCCAAATGCCAAAGTAGGG - Intergenic
914671387 1:149873072-149873094 GGACCCCAAATGCCAAAGTAGGG + Intronic
916832206 1:168504603-168504625 GCACAGCAGAGACCAAAGCAGGG + Intergenic
920033224 1:203049537-203049559 GTACTGCAAAGTCCAAAGCCAGG - Intronic
920597589 1:207288286-207288308 GTACAGCAAACATAAAAGTAAGG + Intergenic
921762644 1:218934392-218934414 GTAGAACAAAAGCCTAAGTAAGG - Intergenic
1064495693 10:15907857-15907879 GTCCAGTAAAGGATAAAGTAAGG + Intergenic
1068176090 10:53460386-53460408 GAACAGGAAATGCCACAGTAAGG - Intergenic
1069797818 10:71064456-71064478 GTAGACCAAAGGCCAGAGAAGGG + Intergenic
1073020456 10:100439241-100439263 GCACAGCAAATGTAAAAGTAAGG - Intergenic
1073699189 10:105906518-105906540 GTACAGTAAAGACCAAAGATTGG - Intergenic
1075185656 10:120254266-120254288 ATACAGCTGAGGCCAAAGTTGGG + Intergenic
1078366356 11:10709694-10709716 GTTTAGGAAAGGGCAAAGTAGGG - Intergenic
1078920888 11:15829469-15829491 GAACATCAAAGCCCAAAATAAGG + Intergenic
1079603327 11:22338069-22338091 GAACAGCAAAGTCAAAAGAATGG - Intergenic
1080055677 11:27904157-27904179 CTGCAGCAAAGGTCAAATTATGG - Intergenic
1080155334 11:29104345-29104367 GTGGAGCAAAGGTCAAAGCAAGG - Intergenic
1080910546 11:36593712-36593734 GTACAGCCGAGGGAAAAGTATGG - Exonic
1083264510 11:61540358-61540380 GTAAAGCAAGGGGCAAATTACGG + Intronic
1083533502 11:63447290-63447312 TTACAGCAAAGGCCAAGCTATGG - Intergenic
1086327090 11:85713166-85713188 GTTCATCAAAGGCCCAAGAATGG + Intronic
1086332602 11:85769067-85769089 ATACAGAAAAGGCCAAAAAAGGG + Intronic
1087140574 11:94761562-94761584 CTTCAGAAAAGTCCAAAGTATGG - Intronic
1088142926 11:106639534-106639556 GTACGATAAAGGCCAAAGAAAGG + Intergenic
1089097128 11:115928399-115928421 GTGCATAAAAGGCCAGAGTAGGG + Intergenic
1091630385 12:2155491-2155513 GTTCCACAAAGGCCAAAGAATGG - Intronic
1092750239 12:11712213-11712235 CTACAGCAAAGGCAAATGAAAGG - Intronic
1094424609 12:30305341-30305363 GTACAAATAAGGCCACAGTATGG + Intergenic
1096979553 12:55720396-55720418 CTACTGCTAAGGCCAAAGTCCGG - Exonic
1097016866 12:55993456-55993478 GGATAGCACAGGCCAAGGTAGGG + Exonic
1097737016 12:63193809-63193831 GAACAGCAAAGGTTAAGGTAGGG + Intergenic
1100667389 12:96769789-96769811 GTCAAGGATAGGCCAAAGTAGGG - Intronic
1101807411 12:108076428-108076450 GAACAGCAAGGGCAAAGGTATGG - Intergenic
1105621720 13:22074147-22074169 TTACAGCAAAGTCCAAAGACTGG + Intergenic
1108020404 13:46122102-46122124 GCACAGCAAAGGGCAAAGCTGGG + Intergenic
1113259006 13:108539882-108539904 GTAGAGCCAAGGAAAAAGTAAGG - Intergenic
1113323145 13:109256910-109256932 TTACATCAAAGGGCATAGTAGGG + Intergenic
1115514288 14:34169740-34169762 GTACAGCAAAGGCCAAAGTATGG - Intronic
1117334719 14:54747286-54747308 GTAATGCAAAGGCCAATGAAGGG - Intronic
1124208990 15:27746728-27746750 CTGCATCAAAGGCCAAAGTTGGG - Intergenic
1126290133 15:47066091-47066113 GTCCAGCAAGGTCCAAAGGAAGG - Intergenic
1126426149 15:48528926-48528948 CGACAGCAAAGGCCAGAATAAGG + Intronic
1130995078 15:88899106-88899128 GGACAGGAAAGGGCAAAGTAGGG - Exonic
1136549718 16:30976509-30976531 GGACAGGAGAGGGCAAAGTACGG + Intronic
1145814206 17:27783751-27783773 GTACAGGAAAGAGCAAAGTCAGG + Intronic
1146291721 17:31612497-31612519 TCACAGAAAAGCCCAAAGTAAGG - Intergenic
1146886902 17:36476970-36476992 GTGTAGCAAAGGCAAAACTATGG - Intergenic
1149039261 17:52168467-52168489 GTTCAACAAAGGCAAAAGCAGGG + Intergenic
1153053400 18:921911-921933 GTAGAGGGAAGCCCAAAGTAAGG + Intergenic
1154045509 18:10901115-10901137 GTTCAGCAAATGCCGAAGGATGG + Intronic
1157326558 18:46673361-46673383 GTACAGAAAAGGCAGAAGTTGGG + Intronic
1161134082 19:2609523-2609545 TTCCAGCAATGGCCAAAATAAGG - Intronic
1166630105 19:44399264-44399286 CTCCAACAAAGGCCAAAATAAGG + Intronic
1166637353 19:44462171-44462193 CTCCAACAAAGGCCAAAATAAGG - Intergenic
928227909 2:29469556-29469578 CTACAGAAAGGGCCAAAGTTAGG - Intronic
929104749 2:38353890-38353912 AGACAGCAAAAGCAAAAGTATGG + Intronic
931968374 2:67558968-67558990 AGACAGCAAAGACCCAAGTAGGG + Intergenic
932553277 2:72794938-72794960 GTAGAGCAAAGGCAAAAGCATGG + Intronic
933030315 2:77320082-77320104 GCTCAACAAAGACCAAAGTAGGG - Intronic
936992131 2:118377383-118377405 GTGCAGCAAAGCACAAAGGAGGG - Intergenic
937477492 2:122228299-122228321 GAACAGCAAAGGCTAAAGTGAGG + Intergenic
938543654 2:132307245-132307267 CTCCAACAAAGGCCAAAATAAGG - Intergenic
939292651 2:140215855-140215877 GTGCATCACAGGCCAAATTACGG + Intergenic
939446899 2:142321799-142321821 GGACAGCAAAGTGCAGAGTAGGG + Intergenic
944926272 2:204468019-204468041 GTAAAGCCATGGCCAAAGCAGGG + Intergenic
945629029 2:212248332-212248354 GTTTAGCAAAGCCCAAATTAAGG - Intronic
945965272 2:216180259-216180281 GTTCAGCAAAGGCAATAGGATGG + Intronic
946390089 2:219409803-219409825 GAACAGCAAAGGCCAAGGTCTGG + Intergenic
947617804 2:231569418-231569440 GTCCAGCAGAGGCCAAACCATGG - Intergenic
948230311 2:236344517-236344539 GGAAAGAAAAGGCAAAAGTAAGG + Intronic
1170072277 20:12381717-12381739 GAACAGCAAATGCAAAAGAAGGG - Intergenic
1171257669 20:23703220-23703242 GGTCAGCAGAGGCCAAAGTCAGG - Intergenic
1172231558 20:33340112-33340134 GTTCAGCAATGTCCAAAGTGGGG + Intergenic
1172772130 20:37388045-37388067 GTGCAGCAGAGGCCACAGGAGGG + Intronic
1174210703 20:48875839-48875861 GCACAGCAAAGGCCAAGGCGGGG + Intergenic
1179614067 21:42570345-42570367 GAACAGCAAAAGCCAAAGTGTGG - Intronic
1181447024 22:22984997-22985019 GAACAGCATATGCCAAAGAACGG + Intergenic
1183398027 22:37584368-37584390 GGACAGCAGAGGACACAGTAGGG - Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
949657675 3:6239498-6239520 AAACAGCAAATGCCAAAATATGG + Intergenic
951736686 3:25873982-25874004 GTAAAGCCAAGCCCAGAGTAAGG + Intergenic
953421371 3:42755996-42756018 AGACAGAAAAGGCCAAAGAATGG + Intronic
955132638 3:56186395-56186417 GTAGAACAAAGGCCAGTGTATGG - Intronic
961514495 3:127424284-127424306 GGACAGCAAGGGCCAAAGGAAGG + Intergenic
962037554 3:131668737-131668759 GTAGAGGAAAGGCCAGAGCATGG + Intronic
963045201 3:141097182-141097204 CTACAGCAATGGCCTATGTAAGG - Intronic
965463656 3:169000315-169000337 GGAAAGCAAAGACCAAAGAAAGG + Intergenic
967366963 3:188698212-188698234 GCACAGCAAAGGCCAAAATATGG + Intronic
968712110 4:2126774-2126796 GGACAGGAAAGGCCAGAGTGAGG + Intronic
970909167 4:21254578-21254600 GTAAGGCAAAGTCCAAAGTAGGG - Intronic
973556552 4:52089664-52089686 CTTCAGCAAATGCAAAAGTATGG - Intronic
976489433 4:85651472-85651494 GTACAGCAAAGGAAAAACTTGGG - Intronic
977745207 4:100538808-100538830 GTGCAGCGAAGGCCAAAGAGAGG + Intronic
978170996 4:105669844-105669866 ATACAGAAAAGGCAAATGTATGG - Intronic
979924369 4:126542097-126542119 GTACAGCTAAGGTTAAAGAAGGG + Intergenic
981028814 4:140103024-140103046 TTACAACAAAGCCCAAATTATGG - Intronic
983889786 4:173018810-173018832 GAACAGCAAAGGCCAGATTGTGG + Intronic
986155371 5:5169526-5169548 GTACACCAAAGGCTCAAGGAAGG - Intronic
988222427 5:28366031-28366053 GCACGGTAAAGGTCAAAGTATGG + Intergenic
994665256 5:102697135-102697157 GAACAGCAAAAGCAAAAGCATGG - Intergenic
995059603 5:107798989-107799011 GTACAGAAAACGCCACAGAATGG + Intergenic
996524482 5:124463518-124463540 TTGCAGCAAAGGACAGAGTAGGG - Intergenic
997638416 5:135432359-135432381 GTCCAGCAAAGGCCAGAGGCAGG + Intergenic
998270905 5:140705773-140705795 GTCCAGCATAGGCCAAAGTCAGG - Exonic
999229111 5:150051229-150051251 TTTCAGCAAAGGCCAAAGGCTGG - Intronic
1001161057 5:169314215-169314237 GTAAAGAAAAGGCAAAACTATGG + Intergenic
1004014709 6:11721304-11721326 GAAGAGCAAAAGCCAAAGCAGGG + Intronic
1005091391 6:22060558-22060580 GTAGAACAAAGCCCAAAATATGG - Intergenic
1005352616 6:24951199-24951221 GTAGAGCAAAGGTCACTGTAGGG - Intronic
1006399490 6:33808405-33808427 GTTAAGCAAAGGCTAAAGCAAGG + Intergenic
1008721035 6:54352632-54352654 AAACAGCAAATGCCAAAGTTGGG - Intronic
1009913612 6:69965188-69965210 ACACAGTAAAGGCCACAGTAGGG - Intronic
1010021758 6:71168306-71168328 TTACAGCAAAGGCAGAATTAAGG + Intergenic
1010029334 6:71256877-71256899 GGACAGCAATGGCCAAAAGAGGG + Intergenic
1011193744 6:84762751-84762773 GGACAGCAAAGGACAGAGAAAGG + Intronic
1013687452 6:112601644-112601666 GAAAAGCAAAGGGAAAAGTAAGG + Intergenic
1020272562 7:6606114-6606136 GTACTGCAGAGGCCAAATTTCGG - Intronic
1021580635 7:22148996-22149018 GCACAGGAAAGGTCCAAGTAAGG + Intronic
1021836212 7:24678089-24678111 ATCCAGCAAAGCCCAGAGTAAGG + Intronic
1022154257 7:27643360-27643382 GTACAGCAGAGGTGAAACTAAGG + Intronic
1024045147 7:45580703-45580725 GTCCCGCAAAGGCCCAAGTGGGG + Intronic
1024420158 7:49156718-49156740 TTATAGCAAAGGCAAAATTATGG - Intergenic
1024497866 7:50068936-50068958 GTTCTGCAAAGGCTAAAGGATGG - Intronic
1027396892 7:77766080-77766102 GTACAGCCATGGCTAAAATATGG - Intronic
1028248765 7:88514761-88514783 GTACATCAATGCCCAAAGCATGG - Intergenic
1030693365 7:112557626-112557648 GCACAGCACAGGCAAAAGCATGG - Intergenic
1031363376 7:120874194-120874216 GTGGAGGAAAGGCGAAAGTAAGG + Intergenic
1033543745 7:142381199-142381221 GTACAGCAGACGCCAACGTGAGG - Intergenic
1034835222 7:154345627-154345649 GAACAGCAAAGCCCAAGGTAGGG - Intronic
1037397336 8:18457003-18457025 GTACAGCAAAGTACAGATTATGG - Intergenic
1038842381 8:31197139-31197161 GGACAGCAAAGGTCAACCTAAGG - Intergenic
1038934856 8:32237997-32238019 ATACAGCAATTGCCAAAGTAGGG + Intronic
1039075711 8:33689085-33689107 GTACATCCAAGACCCAAGTAGGG - Intergenic
1039162380 8:34636950-34636972 GTAAAGCAAAGGCCCAAAAATGG - Intergenic
1041691597 8:60693266-60693288 GTACAGCAAAGACCCATGTTAGG + Intronic
1042322435 8:67491032-67491054 TTACAGCTAAGGCCAAAGAAAGG + Intronic
1043294655 8:78647622-78647644 GTACAGCATATGTCACAGTATGG + Intergenic
1044744976 8:95362972-95362994 GCACAGCAAGAGCCAAAGTGGGG + Intergenic
1047474103 8:125209279-125209301 GTACAACATAGACAAAAGTAAGG + Intronic
1048821243 8:138382505-138382527 GCACAGCAAAGGGCAAAGTCTGG + Intronic
1049175606 8:141190681-141190703 GCACAGCAAAAGCCAAGGTGAGG - Intronic
1049850795 8:144829173-144829195 GCCCAGCAAGGGCCAAGGTAGGG - Intronic
1050828402 9:9979875-9979897 GCACAGCAACGGGCAAAATACGG + Intronic
1058594837 9:106604608-106604630 TTTCAGCAAAGGCCCAAGTTAGG + Intergenic
1058851490 9:109015440-109015462 GCACTGCAAAGGGCAAAGAAGGG + Exonic
1059975904 9:119716891-119716913 GTACCTCAAAGGCCATACTAAGG - Intergenic
1061499341 9:130993254-130993276 GTACAACAAAGCCCACTGTAGGG + Intergenic
1187342388 X:18432840-18432862 GTAGGGGAATGGCCAAAGTAGGG - Intronic
1187422703 X:19150135-19150157 GAGAAGAAAAGGCCAAAGTATGG - Intergenic
1187733595 X:22281659-22281681 GTACAACATAGGGCAAGGTATGG - Intergenic
1188008626 X:25036084-25036106 ATTCAGCAAAGGCCATATTATGG - Intergenic
1188531083 X:31141815-31141837 GCATAGCAGAAGCCAAAGTATGG + Intronic
1191740884 X:64434390-64434412 GCACAGAAAAGGCCCAGGTAAGG - Intergenic
1192725948 X:73752298-73752320 GAAAAGCAGAGGGCAAAGTAAGG - Intergenic
1193880135 X:86911321-86911343 GTACAACTAAGGCCACAGTGGGG - Intergenic
1194057223 X:89150785-89150807 ATACAGCAAGGACTAAAGTATGG + Intergenic
1197535919 X:127689369-127689391 GAAAAGCACAGGGCAAAGTAAGG - Intergenic
1198066599 X:133103736-133103758 GAACAGAAAAGGCTAAACTATGG + Intergenic
1198645225 X:138799441-138799463 GTTCAGCAAATGCAAAAGAATGG - Intronic
1200100033 X:153685714-153685736 GCACAGAAAAGCCCAAAGAAGGG + Intronic