ID: 1115517186

View in Genome Browser
Species Human (GRCh38)
Location 14:34197640-34197662
Sequence GTGTCCTATTTGAAGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115517186_1115517192 30 Left 1115517186 14:34197640-34197662 CCAGGAAACTTCAAATAGGACAC 0: 1
1: 0
2: 0
3: 22
4: 141
Right 1115517192 14:34197693-34197715 TTGAACTGAAAGGTTAAATAGGG 0: 1
1: 0
2: 3
3: 29
4: 336
1115517186_1115517187 -3 Left 1115517186 14:34197640-34197662 CCAGGAAACTTCAAATAGGACAC 0: 1
1: 0
2: 0
3: 22
4: 141
Right 1115517187 14:34197660-34197682 CACTGAGAAACACAATTAAATGG 0: 1
1: 0
2: 0
3: 41
4: 397
1115517186_1115517189 20 Left 1115517186 14:34197640-34197662 CCAGGAAACTTCAAATAGGACAC 0: 1
1: 0
2: 0
3: 22
4: 141
Right 1115517189 14:34197683-34197705 TGAGGATTCCTTGAACTGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 263
1115517186_1115517188 2 Left 1115517186 14:34197640-34197662 CCAGGAAACTTCAAATAGGACAC 0: 1
1: 0
2: 0
3: 22
4: 141
Right 1115517188 14:34197665-34197687 AGAAACACAATTAAATGGTGAGG 0: 1
1: 0
2: 4
3: 23
4: 342
1115517186_1115517191 29 Left 1115517186 14:34197640-34197662 CCAGGAAACTTCAAATAGGACAC 0: 1
1: 0
2: 0
3: 22
4: 141
Right 1115517191 14:34197692-34197714 CTTGAACTGAAAGGTTAAATAGG 0: 1
1: 0
2: 0
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115517186 Original CRISPR GTGTCCTATTTGAAGTTTCC TGG (reversed) Intronic
901738174 1:11325425-11325447 CTGTCCTATTGGCATTTTCCTGG + Intergenic
903727355 1:25460181-25460203 GTGTGCTATTTGCTGTTGCCTGG + Intronic
907699284 1:56767449-56767471 GTGTCTTTCTTGAAGTTCCCTGG - Intronic
909534985 1:76726554-76726576 GTCACTTATTTGAAATTTCCTGG + Intergenic
910615755 1:89196780-89196802 GTGTGCTATTTGAAGTGACCAGG + Intronic
910800437 1:91139486-91139508 TTTTCCTACTTGAAGTTTCCAGG + Intergenic
911506531 1:98759380-98759402 GTGGCCTATTTGATTTTGCCTGG - Intronic
911548917 1:99255543-99255565 GCTTCCCCTTTGAAGTTTCCGGG - Intergenic
913393267 1:118338301-118338323 ATGTCCTAATTGAAGTCTTCAGG + Intergenic
916250451 1:162732751-162732773 GTGTCCTATATGCAGCTTCCAGG - Intronic
916623897 1:166532814-166532836 GTGGCCTATATCAATTTTCCAGG + Intergenic
916624179 1:166535655-166535677 GTGGCCTATATCAATTTTCCAGG - Intergenic
921701706 1:218275923-218275945 GTGTGCTATTTTATGTTTCCTGG + Intergenic
922537562 1:226392396-226392418 GTGTCCTAGTGGAAGGATCCTGG - Intronic
923892920 1:238235570-238235592 GTAACATATTTGAAGTTTCCAGG - Intergenic
1062840318 10:665475-665497 GTTTCTTATGTGAAGTTTCCTGG - Intronic
1065206360 10:23361226-23361248 GAGTCCTCTTGGAAGTTACCAGG - Intergenic
1070661753 10:78311527-78311549 GTGTCCTAACTGATGATTCCTGG + Intergenic
1070722565 10:78766802-78766824 GTGTCCTAACTGATGATTCCTGG - Intergenic
1070800211 10:79240803-79240825 TTGTCTTTATTGAAGTTTCCTGG + Intronic
1071689615 10:87803100-87803122 GTGGCCTATATAAATTTTCCAGG + Intronic
1075478761 10:122760701-122760723 GTAACCTATTTGCAGATTCCAGG + Intergenic
1075805855 10:125188299-125188321 GTTTCTTATTTGCAGTTTCAGGG - Intergenic
1076341691 10:129753313-129753335 GTGTCCTGTTTGCAGTTTTTTGG + Intronic
1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG + Intergenic
1079622370 11:22569460-22569482 GCATCTTATTTGAACTTTCCAGG - Intergenic
1079778941 11:24573771-24573793 GTGTGCTTTTTAAAGTTTCTAGG - Intronic
1079903816 11:26221226-26221248 GTGCCCTGTTTTAACTTTCCTGG - Intergenic
1086366825 11:86115650-86115672 GTTTCTTATTTGGAGTCTCCGGG - Intergenic
1089722639 11:120442585-120442607 GTGGCCTCTTTGAAGTTTGGAGG + Intronic
1089869506 11:121659541-121659563 GTGTCCTTTGTGAAGTCACCAGG - Intergenic
1090034153 11:123233697-123233719 GTCTCCTAATTGAAATTCCCTGG - Intergenic
1090506044 11:127316045-127316067 GTGTCCCATTTGCAGTTTGTTGG + Intergenic
1092531274 12:9347641-9347663 GTGGCCATTTAGAAGTTTCCTGG + Intergenic
1094468241 12:30777804-30777826 GTGGCCTATATCAATTTTCCAGG + Intergenic
1094645788 12:32322666-32322688 GTGTTCTATTTGATGTTTTCTGG + Intronic
1095268490 12:40187881-40187903 GTGGCCTATATCAATTTTCCAGG - Intergenic
1096194166 12:49638298-49638320 ATTTTCTATGTGAAGTTTCCTGG - Exonic
1096452174 12:51752672-51752694 GTGTCCCATTTCAAGACTCCGGG - Intronic
1104030331 12:125060507-125060529 GTGGCCTATATCAATTTTCCAGG - Intergenic
1106805650 13:33303845-33303867 GGGTCCTAGGTGAGGTTTCCAGG - Intronic
1106956652 13:34945494-34945516 GTGTCCTATATGAATTTTATTGG - Intronic
1107790435 13:43996673-43996695 GTGTTCCATTTTAAGGTTCCTGG + Intergenic
1112451331 13:99513426-99513448 ATGTCCTCTCTGAAGTTTCATGG - Intronic
1112959327 13:105103475-105103497 GTTTCCTATTTTAAGTTCCAGGG - Intergenic
1115517186 14:34197640-34197662 GTGTCCTATTTGAAGTTTCCTGG - Intronic
1116286247 14:42975629-42975651 TTCTCCTTTTTGGAGTTTCCAGG + Intergenic
1117845261 14:59905053-59905075 CAGTCCTATTTGAAATATCCTGG - Intergenic
1118631400 14:67706986-67707008 GTGGCCTATATCAATTTTCCAGG - Intronic
1119874790 14:78049523-78049545 ATCTCCTCTGTGAAGTTTCCTGG + Intergenic
1119986817 14:79147724-79147746 GGGTCCTTTTTGAAGTGACCAGG + Intronic
1120372091 14:83649276-83649298 TTGTCTTCTCTGAAGTTTCCTGG + Intergenic
1127232717 15:57014516-57014538 ATGTCCTATTTGCTGCTTCCTGG + Intronic
1134763195 16:16732278-16732300 GTGTCCAATTTCAAAATTCCAGG - Intergenic
1134982857 16:18626871-18626893 GTGTCCAATTTCAAAATTCCAGG + Intergenic
1137008880 16:35303891-35303913 GTGTCCTATTTGCTGGGTCCAGG + Intergenic
1137501405 16:49014235-49014257 CTGGACTATTAGAAGTTTCCAGG + Intergenic
1137741852 16:50784489-50784511 GTGTTCTATTTGCTGTTTTCTGG + Intronic
1140318863 16:73928195-73928217 GTGTGCTCATTGAAATTTCCAGG + Intergenic
1147316023 17:39620702-39620724 GTTTCCTATTTGGGTTTTCCAGG + Intergenic
1148951530 17:51317668-51317690 GTGGCCTATATCAATTTTCCAGG + Intergenic
1155011040 18:21778051-21778073 GAGCCATATTTGAAGTTTCATGG + Intronic
1157951276 18:52040683-52040705 GTGGCCTATTTCTATTTTCCTGG - Intergenic
1158170629 18:54595473-54595495 CTGTCATATTTAAAGTTTCATGG + Intronic
1158820419 18:61152646-61152668 GTTTCTTATGTGAAGTTTTCAGG + Intergenic
925274730 2:2640813-2640835 GTGACATATTTGCAGTTTCCAGG - Intergenic
925648590 2:6064323-6064345 GTGTCCTTTGGGAAGATTCCAGG - Intergenic
928598210 2:32877439-32877461 GTGTCCAGTTACAAGTTTCCAGG - Intergenic
929485364 2:42348553-42348575 GTGACCTATTTGAAGAGTCCAGG - Intronic
931231929 2:60382431-60382453 GTGCCCCCTTTGAAGATTCCAGG + Intergenic
932048302 2:68372599-68372621 GAGTCAGATTTGAAGTTTTCTGG - Intronic
934108440 2:88717896-88717918 GTGGCCTATATCAATTTTCCAGG - Intronic
936655157 2:114476640-114476662 ATTTCCTGTTTGAACTTTCCAGG - Intronic
937502959 2:122503054-122503076 TTGTCCTACTTGATGTTTGCAGG + Intergenic
938278276 2:130047408-130047430 GTGTCTTAGTTTAAGTTTCCTGG + Intergenic
938329247 2:130438213-130438235 GTGTCTTAGTTTAAGTTTCCTGG + Intergenic
938360699 2:130683280-130683302 GTGTCTTAGTTTAAGTTTCCTGG - Intergenic
938437101 2:131289978-131290000 GTGTCTTAGTTTAAGTTTCCTGG - Intronic
943699828 2:190977717-190977739 GTGTCCTGCTTGACCTTTCCTGG + Intronic
945869617 2:215213081-215213103 GTGGCCTATATCAATTTTCCAGG + Intergenic
1171135296 20:22689814-22689836 GTGTCCTATTTTAGGATCCCTGG - Intergenic
1171880142 20:30612614-30612636 GTGTCTTAGTTTGAGTTTCCTGG + Intergenic
1171943586 20:31354460-31354482 GTGCCCTATTTTATGGTTCCAGG - Intergenic
1174065089 20:47858638-47858660 GTCTCCTAATTTAAGTTTCATGG + Intergenic
1174065115 20:47858863-47858885 AGGTCCTCTTTCAAGTTTCCTGG + Intergenic
1179222274 21:39418985-39419007 GTATTCTTTTTGAAGTTTCCTGG + Intronic
1179651637 21:42813386-42813408 GTGGCCTATATGAATTTTTCAGG - Intergenic
1183257641 22:36772920-36772942 ATTTCCTCTTGGAAGTTTCCAGG - Intronic
1184065241 22:42115037-42115059 GTGTCCTATCTGAGGTTCCATGG - Intergenic
1184917851 22:47585161-47585183 GTGGCCTATATCAATTTTCCGGG + Intergenic
949744340 3:7271029-7271051 GTGTCGTCTTAGAAGTTTCAAGG - Intronic
950860492 3:16143730-16143752 GTGGCCTATTTCAAGCTACCAGG - Intergenic
966166630 3:177026418-177026440 GTGGAATATTTGAAGTTTGCTGG - Exonic
967244882 3:187476715-187476737 GTGACCTATATCAATTTTCCAGG + Intergenic
967786228 3:193500159-193500181 GTTTCCTAATTGCTGTTTCCTGG - Intronic
968401453 4:301971-301993 GTGTCAGATTTGAAGATGCCAGG + Intronic
970216719 4:13766729-13766751 GTTTCTTATTTGATCTTTCCTGG - Intergenic
970420182 4:15898726-15898748 GTGTCCTGCTTGATGTATCCTGG + Intergenic
971268965 4:25119653-25119675 TTGTGCTATTTGAAGTTTGCAGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973016453 4:45144963-45144985 ATCTCCTATTTGAAATCTCCTGG - Intergenic
973245323 4:48004686-48004708 GTGGCCTATATGCATTTTCCAGG - Intronic
974935920 4:68409843-68409865 GTGGCCTATATCAATTTTCCAGG + Intergenic
975033465 4:69653179-69653201 GTTTCTTACCTGAAGTTTCCTGG + Exonic
977364665 4:96052756-96052778 GTGTCTTAATTGAAATTTTCTGG - Intergenic
982023989 4:151233672-151233694 GTGACATATTTGCAGGTTCCAGG + Intronic
983343532 4:166498014-166498036 GTTTCTTATTTCATGTTTCCAGG - Intergenic
983413968 4:167432152-167432174 GTGTCCTCTGTGGAGTCTCCAGG - Intergenic
984350980 4:178592903-178592925 TTTTCCTATTAGAAGTTCCCAGG - Intergenic
986205248 5:5618719-5618741 GTGGCCTATTTTAAATTTCAAGG - Intergenic
986338603 5:6772412-6772434 GTGTCCTCTCTGAGGTTTCCAGG + Intergenic
987489420 5:18557685-18557707 GTCTCATAGTTGATGTTTCCTGG - Intergenic
987659303 5:20851675-20851697 GTTTACTTTTTTAAGTTTCCTGG + Intergenic
988764344 5:34353980-34354002 GTTTACTTTTTTAAGTTTCCTGG - Intergenic
993685334 5:90930315-90930337 GTTTCTTATTTGGAGTTTGCCGG - Intronic
1002703743 5:181146726-181146748 GTGGCCTATATTAATTTTCCAGG + Intergenic
1003470422 6:6424844-6424866 GTTTCCTGTTTGAAGTTTATTGG - Intergenic
1003731703 6:8831693-8831715 GTTTCCTTTTTGTAGTTTCTGGG + Intergenic
1003884425 6:10508396-10508418 GGGTAGAATTTGAAGTTTCCAGG + Intronic
1008188588 6:48425645-48425667 GTGTCCAATCTGAAATCTCCAGG - Intergenic
1010477465 6:76305805-76305827 GTGTCTTATTTGAGTTCTCCAGG - Intergenic
1011940106 6:92832646-92832668 GTGGCCTATATCAATTTTCCAGG + Intergenic
1013542282 6:111122506-111122528 CTGTGCTCTTTAAAGTTTCCAGG + Intronic
1013691544 6:112650797-112650819 GTGTCCTCTTTGAATTTTGAGGG + Intergenic
1015646544 6:135396928-135396950 GTATCCTATTTTAACTTTCCAGG - Intronic
1017154796 6:151313203-151313225 GGGTCCTATTTCATGTTTCCAGG - Intronic
1019048542 6:169166450-169166472 GTGACTGATTTGCAGTTTCCAGG + Intergenic
1020338186 7:7081062-7081084 GTGTGCTATTAGAAGCTTTCTGG - Intergenic
1020861719 7:13501739-13501761 GTATTCAATTTGAAGTTTCTAGG - Intergenic
1022480851 7:30742087-30742109 ACGTCCTAATTGATGTTTCCTGG + Intronic
1024935445 7:54707281-54707303 GTGGCCTATATCAATTTTCCAGG - Intergenic
1029299735 7:99570799-99570821 GTGTGCTATTAGAAGCTTTCTGG + Intronic
1030669672 7:112322148-112322170 TTGTCCTACTTGAAGTTTATTGG + Intronic
1033910240 7:146254535-146254557 GTGTCCTATTAGAAGTGTTCAGG + Intronic
1034220880 7:149445392-149445414 GTGTCCCCTTTTAAGTCTCCGGG - Intronic
1035291606 7:157842792-157842814 GTTTCCTATGTGAAGTTCCTTGG - Intronic
1035859973 8:3017701-3017723 TTTTGCTATTTGAAGTTTACTGG + Intronic
1040054543 8:43046178-43046200 GCATCCAATTTAAAGTTTCCAGG - Intronic
1040586397 8:48746910-48746932 GTGTTCTATTCCAAGCTTCCTGG + Intergenic
1040898378 8:52391706-52391728 GTGTCCACTTTGATGTTTGCAGG + Intronic
1042664822 8:71193530-71193552 GTGTCCTCTTTGGGTTTTCCAGG - Intergenic
1043100484 8:76039226-76039248 GTGTGTTAGATGAAGTTTCCTGG + Intergenic
1045807440 8:106181012-106181034 CTGACATATTTGAAGTGTCCTGG + Intergenic
1046724075 8:117655549-117655571 GTGGGGAATTTGAAGTTTCCAGG + Intergenic
1046724597 8:117660724-117660746 TTGACCTATCTGAAGTTTCTGGG + Intergenic
1047726915 8:127691992-127692014 GTTTTATATTTGAGGTTTCCTGG - Intergenic
1049939028 9:527179-527201 GCGTCCCTTCTGAAGTTTCCAGG + Intronic
1052630689 9:31034962-31034984 GTCTTCTATGTGAAGTTTCTAGG + Intergenic
1055989460 9:82090101-82090123 ATGTGCTATTTTAAATTTCCTGG + Intergenic
1056249203 9:84731001-84731023 TTGTTATATTGGAAGTTTCCCGG + Intronic
1058426496 9:104879830-104879852 GTGTGCTTCTTGAAGTTTACTGG - Intronic
1059901310 9:118929175-118929197 GTGTGTTCTGTGAAGTTTCCAGG + Intergenic
1186010935 X:5132030-5132052 ATGTCCTATTTGTAGTTTGCTGG - Intergenic
1188024938 X:25198251-25198273 GTGACCTACTTGAGATTTCCAGG + Intergenic
1194386519 X:93262308-93262330 GTGCCCTATTTCAAATTTCTTGG - Intergenic
1194887081 X:99329846-99329868 GTGGCCTATATAAATTTTCCAGG + Intergenic
1195461634 X:105132826-105132848 GTGCACAATTTGAAGTTTCTTGG + Intronic
1196542346 X:116924456-116924478 GTGGCCTATTTGGATTTTCCAGG - Intergenic
1197965941 X:132061815-132061837 GAGTCCAATTTAAAATTTCCAGG - Intergenic
1198576417 X:138014724-138014746 GGGCCCTATTTGAGGTTTCTGGG + Intergenic
1199299627 X:146197742-146197764 GTGTACCATATGAAGTTGCCTGG - Intergenic
1199882467 X:151985420-151985442 GAGTCCAAGTGGAAGTTTCCAGG + Intergenic
1200237730 X:154476819-154476841 GTGTCCTGTGTGGAGTTTCCTGG + Intergenic
1201514965 Y:14809972-14809994 GTCTCCAATTTTAATTTTCCTGG + Intronic