ID: 1115517710

View in Genome Browser
Species Human (GRCh38)
Location 14:34202576-34202598
Sequence GAGATTTGGCAGTATGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115517705_1115517710 10 Left 1115517705 14:34202543-34202565 CCCAAATCTCAGATAGGAGTCAG 0: 1
1: 0
2: 0
3: 19
4: 157
Right 1115517710 14:34202576-34202598 GAGATTTGGCAGTATGAGCTTGG 0: 1
1: 0
2: 1
3: 5
4: 136
1115517702_1115517710 28 Left 1115517702 14:34202525-34202547 CCTTCTTACAGAAAAATCCCCAA 0: 1
1: 0
2: 5
3: 43
4: 2178
Right 1115517710 14:34202576-34202598 GAGATTTGGCAGTATGAGCTTGG 0: 1
1: 0
2: 1
3: 5
4: 136
1115517704_1115517710 11 Left 1115517704 14:34202542-34202564 CCCCAAATCTCAGATAGGAGTCA 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1115517710 14:34202576-34202598 GAGATTTGGCAGTATGAGCTTGG 0: 1
1: 0
2: 1
3: 5
4: 136
1115517706_1115517710 9 Left 1115517706 14:34202544-34202566 CCAAATCTCAGATAGGAGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 117
Right 1115517710 14:34202576-34202598 GAGATTTGGCAGTATGAGCTTGG 0: 1
1: 0
2: 1
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115517710 Original CRISPR GAGATTTGGCAGTATGAGCT TGG Intronic
903154597 1:21435414-21435436 GAGATGTGGCAGTGTGGGATGGG + Intergenic
905196258 1:36280154-36280176 GGATTTTGGCAGTATGACCTTGG + Intronic
906648237 1:47491557-47491579 GGGATTTGTCAGCACGAGCTGGG + Intergenic
907849096 1:58236785-58236807 CGGATTTGGCATTAGGAGCTTGG - Intronic
908578221 1:65484557-65484579 GAGACTTGTCAATATGAACTAGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
915675056 1:157521814-157521836 GCGATTTGGGAGTATGAGGCAGG + Intronic
917224783 1:172769937-172769959 GAGAGTTGGTAGTTTGAACTAGG - Intergenic
920430538 1:205915820-205915842 GAGATTTGGCAGACTGATTTCGG - Intronic
922593430 1:226796165-226796187 GACAATTGGCAATAGGAGCTGGG - Intergenic
923593020 1:235337120-235337142 GATGTCTGGCAGTAAGAGCTGGG - Intronic
1068265790 10:54647546-54647568 AGGATTTGGCAGCATGAGCCAGG + Intronic
1069832797 10:71291359-71291381 GGGATTTTGCAGTGGGAGCTGGG + Intronic
1070067144 10:73047857-73047879 GAGATTTCGCTGTGTGACCTAGG - Intronic
1070841059 10:79488177-79488199 GATATTTGGCCGTATCAGATGGG - Intergenic
1072417723 10:95262894-95262916 GAAATTTGGGAGTCTGAGGTGGG + Intronic
1072574453 10:96687428-96687450 GACATTTGGAAGTGTGAGATTGG - Intronic
1076442776 10:130491991-130492013 GTGTTTTTCCAGTATGAGCTGGG - Intergenic
1076700964 10:132272464-132272486 GGGCTGTGGCAGTGTGAGCTAGG - Intronic
1077105506 11:840627-840649 GAGATCTAGCAGTATGATCCTGG + Intronic
1077162560 11:1120380-1120402 GAGATTTGGGAGGCTGAGATGGG - Intergenic
1079654930 11:22975472-22975494 GAGATTTGGGAAGATGAGTTAGG + Intergenic
1084880480 11:72167924-72167946 GCCATTTGGGAGGATGAGCTGGG - Intergenic
1085677062 11:78532577-78532599 GTGACTTGCCCGTATGAGCTAGG - Intronic
1085858987 11:80210318-80210340 GAGATTAGGAAGTTTGTGCTTGG + Intergenic
1086350916 11:85942609-85942631 AACATTTGGCAGCATGAGGTTGG + Intergenic
1086432049 11:86745414-86745436 GAGAATAGGCAGGATGAGGTGGG + Intergenic
1090734287 11:129597872-129597894 GATTTTTGACAGTATGAGATAGG - Intergenic
1096063567 12:48722122-48722144 GATATTTGGCAGGCTGAGGTGGG - Intergenic
1097018833 12:56005974-56005996 GAGGTTTGGCAGTATCTGCAGGG + Intronic
1097516971 12:60618127-60618149 GAGACTGGGCAGTTTGGGCTGGG + Intergenic
1102476626 12:113192827-113192849 CAGATTGGGCAGTGTGGGCTGGG + Intergenic
1108398011 13:50008767-50008789 GTGTTTTGGCAGTCTGAGGTGGG + Intronic
1108597123 13:51959281-51959303 GAGCTTTGGGAGACTGAGCTTGG + Intronic
1109239079 13:59861122-59861144 GAGATTTAGCAGTAGAAGGTAGG + Intronic
1110431583 13:75430435-75430457 GAGATTTTGAAGTACGTGCTTGG - Intronic
1115041365 14:28933098-28933120 GAGATTTGGAAGCAGGAGCATGG - Intergenic
1115517710 14:34202576-34202598 GAGATTTGGCAGTATGAGCTTGG + Intronic
1116970343 14:51058385-51058407 GAGATCTAGTAGTATTAGCTAGG + Intronic
1117273215 14:54166251-54166273 GAGATTTAGCAGGATAATCTTGG - Intergenic
1118943370 14:70359625-70359647 GAGATTTGGGAGTCTGCGCTAGG - Exonic
1120791401 14:88587031-88587053 TTGATTTTGCTGTATGAGCTTGG - Intronic
1124585293 15:30999967-30999989 GAGATTTCTCAGAATAAGCTGGG - Intergenic
1131807987 15:96142796-96142818 GAGAGGTGCCAGTATGAGCCTGG - Intergenic
1134050741 16:11135570-11135592 TCGCTTTGGCAGTATGAGTTAGG - Intronic
1135195155 16:20388043-20388065 GAGATTTGGGAGGAGGAGTTTGG + Intronic
1138781364 16:59792007-59792029 CAGTTTTGGCTGTAAGAGCTTGG - Intergenic
1141936275 16:87240767-87240789 CAGATGTGGCAGAATGGGCTGGG + Intronic
1141980273 16:87545890-87545912 GATATTTGGAAGTCTGAGGTGGG + Intergenic
1144868025 17:18349470-18349492 GAGATTTGGAAGGCTGAGGTGGG + Intronic
1146602193 17:34227603-34227625 GGGATTTGGGAGGCTGAGCTGGG - Intergenic
1149380582 17:56089570-56089592 AAGATTTGCCAGTAGGAGCTAGG + Intergenic
1152037999 17:77885123-77885145 GACATTTGGCAGAAGGAGGTGGG - Intergenic
1152468988 17:80480649-80480671 GAGATACGGCAGGATGAGCAAGG - Intergenic
1153629686 18:7057584-7057606 GAGATTTGGGAGGCTGAGGTAGG - Intronic
1155356096 18:24955607-24955629 GAGATTTGGCATCATGGACTAGG - Intergenic
1156860310 18:41828429-41828451 GAGATATGGTTGGATGAGCTGGG + Intergenic
1158508384 18:58067596-58067618 GAGAAATGGAAGTGTGAGCTAGG + Intronic
1159199061 18:65159960-65159982 GAGGTTTGGCAGTATGAGGTGGG + Intergenic
1159463863 18:68754513-68754535 GAGATTTGGGAGGCTGAGGTGGG + Intronic
1165549453 19:36571804-36571826 GAGATTTGGCAGTGTGACATTGG - Intronic
1168472284 19:56649508-56649530 GGGGTTTGGGAGTAGGAGCTGGG + Intronic
928408867 2:31038424-31038446 GAGATATGACTGTATGAACTCGG + Intronic
929575985 2:43052208-43052230 GAGAGTTGGCAATTGGAGCTGGG + Intergenic
931061448 2:58534007-58534029 GAGATCAGGAAGAATGAGCTTGG + Intergenic
932247021 2:70204596-70204618 AACATTTGGCAGCATGAGGTTGG + Intronic
933435822 2:82248671-82248693 GTGATTTGTCACTATCAGCTAGG + Intergenic
934621187 2:95808711-95808733 GATATTTGGGAGGATGAGGTAGG - Intergenic
934812255 2:97290117-97290139 GATATTTGGGAGGATGAGGTAGG + Intergenic
934825439 2:97417806-97417828 GATATTTGGGAGGATGAGGTAGG - Intergenic
936570945 2:113614763-113614785 GAAATTTGACAGTATGTTCTTGG + Intergenic
937870597 2:126783271-126783293 CAGAGCTGGCAGTATGAGTTGGG + Intergenic
939053730 2:137336418-137336440 GAGATTTTGCAGTATCAGTGTGG + Intronic
941723322 2:168835475-168835497 GAGAGGTGGCAGCATCAGCTTGG + Intronic
944110285 2:196124482-196124504 AAGATTTGGGTGTATGGGCTGGG + Intergenic
945089663 2:206167035-206167057 GAGATTTTGCAGTGTGTGTTTGG + Intergenic
945520137 2:210816972-210816994 CAAATTTGGTAGTATGATCTAGG + Intergenic
947591523 2:231388710-231388732 AATATGTGGCAGTATGTGCTGGG + Intergenic
1173597557 20:44268995-44269017 GTGGCTTGGCAGTATGGGCTGGG + Intronic
1173773522 20:45684256-45684278 GAGATTGGGGAGCATGAGGTGGG + Intergenic
1173904665 20:46617510-46617532 GATATTTGGCAGAAAGAGCCTGG - Intronic
1179400733 21:41080723-41080745 GAGGTTAGGCAGGATGAGATAGG + Intergenic
953278937 3:41533163-41533185 GTGCTTTGGCAGCATGATCTGGG - Intronic
954562361 3:51568491-51568513 GAGATTTGGCAGTTTTTTCTAGG + Intronic
955222137 3:57031845-57031867 GAGATGTGGGAGCATGAACTTGG + Intronic
972329823 4:38054780-38054802 GAGATTTGGCCTTTTGACCTGGG + Intronic
972792052 4:42382390-42382412 TAGATTTGGCCTTATGACCTTGG + Intergenic
974635121 4:64554012-64554034 GAGATTTGCCAGTGTAATCTGGG - Intergenic
983083833 4:163419228-163419250 CAGATTTGGCTGTGTGAGTTGGG + Intergenic
984316716 4:178139236-178139258 AACATTTGGCAGTATGCGGTTGG + Intergenic
984406507 4:179338459-179338481 GTGATTTGGCAGTAAGATGTGGG - Intergenic
984824240 4:183910008-183910030 CAGATTTGGTAGCATGAGTTGGG - Intronic
985552984 5:542667-542689 GAGATTTGGCCTGAGGAGCTGGG - Intergenic
986840541 5:11691776-11691798 GATATATGGCAGTTTGAGGTGGG + Intronic
988067958 5:26246410-26246432 GATATATGGCAGTATAAACTGGG + Intergenic
988710438 5:33769086-33769108 GAGAGATGGCAGTATGAGAAAGG + Intronic
992128919 5:73671655-73671677 GAGAATTGTCAGTATCAGCTGGG + Intronic
997392795 5:133530829-133530851 GAGACCTGGCAGGCTGAGCTGGG + Intronic
998402483 5:141855081-141855103 GATATTTGGGAGTCTGAGGTGGG - Intronic
1000722863 5:164730153-164730175 GAAATTTGGCAGAATCATCTTGG + Intergenic
1002468767 5:179422268-179422290 GAGAGGAGGCAGAATGAGCTTGG + Intergenic
1002583644 5:180226926-180226948 GAGAAGTGGAAGTATGAGCTGGG - Intergenic
1007187827 6:39987492-39987514 GGGATTGGGAAGTATGGGCTTGG + Intergenic
1007304345 6:40892437-40892459 GGGATGGGGCAGAATGAGCTAGG + Intergenic
1010110131 6:72217863-72217885 GAGATTTGGGTGTGTGACCTTGG + Intronic
1011614211 6:89183223-89183245 GGGACTTGGCAATATGAACTTGG + Intronic
1014941619 6:127447115-127447137 GAGATTTAGCAGGGTGATCTGGG + Exonic
1015356069 6:132278221-132278243 GAAGTTTGGGAGTCTGAGCTGGG - Intergenic
1015560329 6:134508496-134508518 AAGATTTGGCAGTATTTGTTGGG - Intergenic
1018593042 6:165448617-165448639 GGTATTTGGCACTGTGAGCTGGG - Intronic
1018717181 6:166542470-166542492 GAGCTTTGGGAGGAGGAGCTGGG + Intronic
1020214422 7:6178749-6178771 GAGCTTTGACTGGATGAGCTTGG - Intronic
1021566407 7:22021037-22021059 GAGATTTGGGAGGCTGAGGTGGG - Intergenic
1026250775 7:68668569-68668591 GAGTTTTTGCAGAATCAGCTGGG - Intergenic
1030938924 7:115620642-115620664 GTAATTTGGTAGTATGAGATGGG - Intergenic
1035031815 7:155865773-155865795 GAGACTTGGGAGGAAGAGCTGGG + Intergenic
1035513905 8:215215-215237 GAAATTTGATAGTATGTGCTTGG + Intergenic
1035525408 8:308689-308711 GACATTTGGCAGTGTTTGCTCGG - Intergenic
1037093266 8:14949017-14949039 GTGATTTGGCAGTATGTGAGGGG - Intronic
1037690190 8:21175276-21175298 GAGCTTTGGGAGTCTGAGGTGGG - Intergenic
1037722993 8:21460359-21460381 GAGATTTGGCAGAAGGGGCAGGG - Intergenic
1038180345 8:25221600-25221622 AAGATTTGGCAGAATGGGCCGGG - Intronic
1039554108 8:38464910-38464932 GAGATTTGCTGGTATGAACTTGG - Intronic
1040037274 8:42882813-42882835 GAAATTTGGGAGGATGAGGTGGG + Intronic
1046826603 8:118698790-118698812 GGGATTTGGCTGTATGGGATGGG + Intergenic
1047014115 8:120704202-120704224 GAACTTTGGGAGTATGAGGTGGG + Intronic
1048104029 8:131387899-131387921 GAGATTGGGAAGAATGAACTGGG - Intergenic
1049190021 8:141282172-141282194 GAGGTTGGGCAGGATCAGCTCGG - Intronic
1051214395 9:14780550-14780572 AAGATTTGGCAGCATGTTCTAGG - Intronic
1054731754 9:68707829-68707851 TACATTTGGCCGTATGACCTGGG + Intronic
1054966296 9:71030784-71030806 GATATTTGGCAGTTTTACCTGGG + Intronic
1057723199 9:97549137-97549159 TAGATTTGGCTGCATGTGCTGGG + Intronic
1057846431 9:98529892-98529914 GAGAAGTGGAAGGATGAGCTAGG - Intronic
1057994233 9:99805535-99805557 GAGACTTGGGAGTCTGAGGTGGG - Intergenic
1058684908 9:107471464-107471486 GTGATATGGCAGTAGGAGCCTGG + Intergenic
1060877061 9:127091226-127091248 GAGATTTAGCAGTATGCCCAAGG + Intronic
1186897435 X:14018019-14018041 GACATTTTACAGAATGAGCTAGG - Intronic
1188043707 X:25401178-25401200 GAGATCTGCCAGTGTGATCTTGG + Intergenic
1189393138 X:40594434-40594456 GTGATTGTGTAGTATGAGCTAGG + Intronic
1189554134 X:42124787-42124809 GAGATTTGAGAGTATGTGTTGGG - Intergenic
1193317724 X:80083183-80083205 TAGATTTAGCATTATGGGCTGGG - Intergenic
1194169374 X:90563352-90563374 GAGAATTGGTAGTAGGAGTTGGG + Intergenic
1198409966 X:136356749-136356771 GAGATTTGGGAGGCTGAGGTGGG + Intronic