ID: 1115520774

View in Genome Browser
Species Human (GRCh38)
Location 14:34231088-34231110
Sequence GGCCCACTCCATGTTCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115520774 Original CRISPR GGCCCACTCCATGTTCCCAG TGG (reversed) Intronic
902189075 1:14748344-14748366 TGCCCACTCTATATCCCCAGAGG - Intronic
903885596 1:26539318-26539340 GGCACAGGCCATGTTCCCTGCGG + Intronic
904750752 1:32740503-32740525 AGCCCCCTGCATGTCCCCAGGGG - Intergenic
905142587 1:35859807-35859829 GGCCCACTCCACCGTCCTAGGGG + Intergenic
905212961 1:36386747-36386769 GCCCCACTCCCTTGTCCCAGAGG + Intergenic
905819050 1:40975616-40975638 GGCCAACTCTATGATCCCATTGG - Intergenic
906685613 1:47761330-47761352 GCCCCACTCCCTGACCCCAGGGG - Exonic
910757930 1:90710962-90710984 GGCCCTCTCCAAGTCCCCCGGGG + Intergenic
916992995 1:170265316-170265338 AGCTCAGTCCATGTTCTCAGAGG - Intergenic
919814174 1:201427373-201427395 GGTCCATTCCAAGTTCCCTGTGG - Intronic
920734764 1:208522633-208522655 GGCCCACTCCGTGTCCCCTGAGG - Intergenic
920845349 1:209588868-209588890 AGCCCTTTCCATGCTCCCAGTGG - Intronic
921530541 1:216277235-216277257 TGCCTCCTACATGTTCCCAGAGG - Intronic
921773355 1:219069685-219069707 TCCCCACTCCAGGTACCCAGAGG - Intergenic
922722264 1:227905053-227905075 GGCCCACTCCTTCTGTCCAGGGG - Intergenic
922831236 1:228555604-228555626 GGAGCACTCCCTGTTCCGAGCGG + Intergenic
1062799783 10:370414-370436 GGCCCTCTCCCTGTCTCCAGGGG + Intronic
1069907358 10:71739660-71739682 GGCCCCCGCGATGTTGCCAGAGG - Intronic
1070566418 10:77606750-77606772 GGAATACTCCAAGTTCCCAGAGG - Intronic
1074508639 10:114093763-114093785 GGGCCCCTCTATGTTCCCAGAGG - Intergenic
1075571744 10:123551406-123551428 GAGCCACGCCATGTTCCGAGGGG + Intergenic
1077044795 11:540034-540056 GGCCCATTCCAGGCTCCCATGGG + Intronic
1077143162 11:1033735-1033757 GTCCCACCCCCTGTACCCAGAGG + Intronic
1077240200 11:1506789-1506811 GGCTCACCTCCTGTTCCCAGGGG + Intergenic
1077311232 11:1889909-1889931 GGCCCAGCCCCTGGTCCCAGTGG - Exonic
1077311734 11:1891801-1891823 GGCACCCTCCATGTACCCAGGGG + Exonic
1079097315 11:17519177-17519199 GCCTCACTCCCTGTTCCCCGGGG - Intronic
1080625576 11:34027866-34027888 GGCCCACTCCCTGATCTCTGGGG - Intergenic
1083943583 11:65911744-65911766 GGGCCAGACCAGGTTCCCAGAGG + Intergenic
1084062543 11:66685703-66685725 GGACGAGTCCATGTTCCCAAGGG - Exonic
1084358008 11:68652308-68652330 GGCCCCCTTCATCTCCCCAGAGG + Intergenic
1085134014 11:74068573-74068595 GGACCAATCACTGTTCCCAGAGG + Intronic
1086186739 11:84026691-84026713 TCCCCACTCCATATTCCCAGTGG + Intronic
1088973514 11:114794364-114794386 GGCCAACTAAATGTCCCCAGAGG - Intergenic
1089163782 11:116459353-116459375 GGCACAGTTCATTTTCCCAGGGG + Intergenic
1090404432 11:126468370-126468392 TGCCCACTGCAGGCTCCCAGCGG - Intronic
1090915520 11:131159303-131159325 GGCCCACACCTTTCTCCCAGTGG + Intergenic
1091688702 12:2581495-2581517 TGCCCACTGCAGGTTCTCAGAGG - Intronic
1092352320 12:7765707-7765729 AGCCAACTCCATCTGCCCAGTGG - Intronic
1102346272 12:112163243-112163265 GGCCCACACCATGTACCAAGTGG - Exonic
1104952481 12:132447847-132447869 GGCGCCCTCGAGGTTCCCAGAGG - Intergenic
1105633923 13:22199177-22199199 GGCCCTCTGCATCTTCCCTGTGG + Intergenic
1105837339 13:24223196-24223218 GCCCCACTCCATGGTCCTGGTGG + Exonic
1106484030 13:30156981-30157003 CCCCCAGTCCATGGTCCCAGAGG + Intergenic
1106576364 13:30979165-30979187 GGCCCGCTCCAATCTCCCAGCGG - Intergenic
1110661047 13:78059776-78059798 GGCCCACTCCATCTTGGGAGCGG + Intergenic
1113485277 13:110648501-110648523 GTCCCCCTCCATCTTCCCAAAGG + Intronic
1114216603 14:20661949-20661971 AACCCACTTCATCTTCCCAGAGG + Intergenic
1114548349 14:23518954-23518976 GCACCATTCCATGTTCCCAGTGG - Intergenic
1115520774 14:34231088-34231110 GGCCCACTCCATGTTCCCAGTGG - Intronic
1117022797 14:51589004-51589026 GGTCAACTGCATGTTCCCATGGG - Intronic
1117632034 14:57703930-57703952 GGCTCACTGCATCATCCCAGAGG - Intronic
1121123399 14:91390617-91390639 AGCCCACTGCACCTTCCCAGTGG + Intronic
1121242780 14:92441931-92441953 GGCACACAGCATGTGCCCAGGGG + Intronic
1121317416 14:92970510-92970532 GGGCCACTCCCGGTTCCTAGGGG + Intronic
1122255612 14:100473530-100473552 GGAGCACTCCTTCTTCCCAGAGG - Intronic
1123174292 14:106401960-106401982 GGCCCACCCGGTGTTCCCTGTGG - Intergenic
1123182504 14:106482895-106482917 GGCCCACCCGGTGTTCCCTGTGG - Intergenic
1202944399 14_KI270726v1_random:13834-13856 GGCCCACCCGGTGTTCCCTGTGG + Intergenic
1127804487 15:62506294-62506316 GACCCAGTCCAGTTTCCCAGAGG - Intronic
1128317415 15:66669935-66669957 CGCCCACTCCATATTCAGAGGGG - Intronic
1129230032 15:74192017-74192039 GGCTCACCCCATCTTCCCATGGG - Intronic
1132864586 16:2087168-2087190 GGCCCCCACCATCTCCCCAGTGG + Intronic
1133329962 16:4966820-4966842 GGCCAAGTGCATGGTCCCAGCGG + Intronic
1134857831 16:17535524-17535546 GTCCAACTCCAAATTCCCAGGGG + Intergenic
1137698594 16:50479072-50479094 TGCACACTCCATGGTGCCAGTGG - Intergenic
1137705904 16:50535727-50535749 GGCCAACTCCATGTGACCTGTGG - Intergenic
1139968425 16:70758554-70758576 GGCCCTCTCCATGGTCCCGATGG - Intronic
1141721232 16:85756424-85756446 CGCTCACTCCATCTTCACAGCGG - Intergenic
1141812457 16:86384680-86384702 GTCTCATTCCATCTTCCCAGCGG + Intergenic
1142224719 16:88871883-88871905 CTCCCACTCCTTGTTTCCAGGGG - Intergenic
1143640333 17:8192711-8192733 TGGCAACTCCATCTTCCCAGTGG + Intergenic
1144212813 17:13029619-13029641 TGTCCTCTCCATGTCCCCAGGGG + Intergenic
1144909979 17:18672749-18672771 CGCCGACTCCATGATCCCCGAGG - Intronic
1147610084 17:41796672-41796694 GGGCCACTCTTTGTTCCCAAGGG + Intergenic
1147744057 17:42684299-42684321 CACCCCCTCCATTTTCCCAGAGG - Intronic
1150118296 17:62575282-62575304 GGCTCACTCCAAGACCCCAGAGG - Intronic
1150387669 17:64774165-64774187 GGCTCACTCACAGTTCCCAGCGG + Intergenic
1151194458 17:72421649-72421671 GGCCCACTCACTGTCCCAAGAGG + Intergenic
1151393881 17:73806967-73806989 GGCTCACTGCCTGGTCCCAGAGG + Intergenic
1151400995 17:73855984-73856006 GACCCACTCCCTGTCCTCAGGGG - Intergenic
1152657690 17:81527578-81527600 TGTCCACCCCATGCTCCCAGCGG - Intergenic
1152859981 17:82690885-82690907 TGCCCACTCCATGCTCCCCCGGG - Intronic
1152906814 17:82974872-82974894 GCCCGACTCCATCCTCCCAGGGG + Intronic
1152907142 17:82975854-82975876 GCCCGACTCCATCCTCCCAGGGG + Intronic
1152907226 17:82976101-82976123 GCCCGACTCCATCCTCCCAGGGG + Intronic
1152907368 17:82976532-82976554 GCCCGACTCCATCCTCCCAGGGG + Intronic
1155222765 18:23700272-23700294 GGCCCAATCCAGGCTCCAAGAGG - Intronic
1156454298 18:37284396-37284418 GGCCCAGGCCAGGCTCCCAGAGG - Intronic
1157724939 18:49957208-49957230 GCCCCTCTCAATGTTCCCTGTGG + Intronic
1157887168 18:51379909-51379931 GACCCAGTCAATGTTCCCACGGG - Intergenic
1159089835 18:63835471-63835493 GGCACCCTTCATGTTTCCAGAGG + Intergenic
1161326032 19:3664739-3664761 GGCCCCATCCATGCTACCAGTGG + Intronic
1161346155 19:3769789-3769811 GGCCCTGTGCATGTCCCCAGTGG - Exonic
1161778182 19:6275195-6275217 GGCGAAGTCCAAGTTCCCAGAGG - Intronic
1163027446 19:14520538-14520560 GGCCCACTCAATGATCTCTGAGG + Intronic
1163693512 19:18750576-18750598 GGGCCACACCAGGTTCCCTGGGG - Intronic
1165601499 19:37058628-37058650 GGCCCATTCCTGGTTCTCAGAGG + Intronic
1166978806 19:46620872-46620894 TGCCCACCCCAAGTCCCCAGGGG - Exonic
926706644 2:15842266-15842288 GGCTCAATCCATGTTCACACAGG + Intergenic
927792060 2:26018060-26018082 GGCCCGCTCCATGTCCTCAGAGG - Intergenic
929578683 2:43068432-43068454 GGCCCCCTCCAGGTGCACAGAGG - Intergenic
931696705 2:64876368-64876390 TCCCCACTTCATGTTGCCAGAGG - Intergenic
933814359 2:86053699-86053721 AGGCCTCTGCATGTTCCCAGTGG - Intronic
935234936 2:101130343-101130365 GGCCCACTGCAGGGTCGCAGAGG + Intronic
937043386 2:118837624-118837646 GGCCCACTCCATCTCCAGAGTGG + Intergenic
942124092 2:172805642-172805664 GGCCAAGTGGATGTTCCCAGTGG - Intronic
942750925 2:179286308-179286330 GTCCCAATTCATGTTCCCATTGG + Intergenic
1170952127 20:20946613-20946635 GGGTCACACCATGTTCCCAAAGG - Intergenic
1172446365 20:34995565-34995587 GGCCCACACCTTGTTCTCAGTGG - Exonic
1174415572 20:50363977-50363999 GGCCCACTGTCTGATCCCAGGGG - Intergenic
1175520987 20:59602836-59602858 CTCCCACTCCAAGTCCCCAGGGG - Intronic
1176128222 20:63485379-63485401 GGAGCACTCCCTGTTCCCACTGG - Intergenic
1176171915 20:63699928-63699950 GACCCAGGCCATGTTCCCAAAGG - Exonic
1178440293 21:32593066-32593088 GGCCCTGTCCTTCTTCCCAGAGG + Intronic
1179271656 21:39856147-39856169 GGCCCACTCTATGTCAACAGAGG - Intergenic
1181235539 22:21445893-21445915 GCCCCACTCCTTCTTCCGAGTGG - Exonic
1181547093 22:23608242-23608264 GGCCCTCACCATGCTGCCAGAGG + Intergenic
1183173682 22:36206158-36206180 GGCCCACTCATTATTCCCAGAGG + Intergenic
1183314709 22:37130443-37130465 GGCCCACCCCCACTTCCCAGGGG - Intronic
1184457146 22:44617057-44617079 CGGCCACTTCCTGTTCCCAGAGG + Intergenic
1184631555 22:45784634-45784656 GACCCCCTCCCTGTGCCCAGAGG + Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
950852049 3:16071222-16071244 GGCCCACTCCATCTTCTCAAAGG + Intergenic
953815608 3:46153847-46153869 GGGACACTCCTTCTTCCCAGAGG + Intergenic
954223952 3:49171163-49171185 GGCCCAGGCCATGTCCCCAGTGG + Intergenic
954392331 3:50274267-50274289 ATCCCCCTCCATGTTCCCAGAGG + Intronic
954414155 3:50384811-50384833 GGCCCTCTCCCTGGTCCCAGAGG - Intronic
955019179 3:55102286-55102308 GACCCACTCCAAGCTCCAAGAGG + Intergenic
960317208 3:116192747-116192769 GTGCTACTCCATGTTTCCAGTGG + Intronic
963044433 3:141092506-141092528 GGCCCACTCCTGGTGCACAGGGG - Intronic
969396746 4:6926790-6926812 GGCCCACAGCAGGTACCCAGAGG + Intronic
974807589 4:66899776-66899798 GGACCAGTGCAAGTTCCCAGTGG - Intergenic
975040955 4:69743855-69743877 GGCCCCCACCTTGTTCCCACAGG - Intronic
978296772 4:107214551-107214573 TGCCCACTCCATGCTGCCAACGG - Intronic
978369431 4:108015699-108015721 GGACCCCTCCATGTTACCATGGG - Intronic
982562106 4:156942139-156942161 GGCCGCCTGCATGTTCTCAGTGG + Intronic
983064324 4:163191694-163191716 GGCCCACTCCATTTCTGCAGGGG + Intergenic
985701801 5:1378033-1378055 GGACCACTCCATGTTCACCCGGG + Intergenic
987292366 5:16520902-16520924 GTCCCTCTCCGTGTTTCCAGAGG - Intronic
990162344 5:52956178-52956200 GGCACACTCCATGGAGCCAGTGG - Exonic
992939999 5:81751708-81751730 CGCCCCCGCCCTGTTCCCAGAGG + Intronic
992994405 5:82318312-82318334 GGCCCCCACCATGTCCACAGTGG + Exonic
997358644 5:133280453-133280475 GGCCCAGTCCATGTCCCAAATGG - Intronic
998527076 5:142852329-142852351 GGCCAATTCCATGTCCCCAGAGG - Intronic
999155398 5:149454155-149454177 AGCCCACTCCATGATCTCACAGG + Intergenic
999687091 5:154112784-154112806 GGCACACTCCCTTTTCCCTGGGG + Intronic
1000268300 5:159658786-159658808 TCCCCACTCTCTGTTCCCAGAGG - Intergenic
1006347808 6:33497703-33497725 TGCCCACTCCATGAAGCCAGTGG + Intergenic
1011657648 6:89566218-89566240 GGCCAATTCCTTGTTCCAAGTGG - Intronic
1013273333 6:108561364-108561386 CGCCGACTCCATGATCCCCGAGG + Exonic
1015294649 6:131576798-131576820 GACACACTCCAGGTTCACAGGGG - Intronic
1015791046 6:136964868-136964890 AGCCCATTGAATGTTCCCAGTGG + Intergenic
1018192766 6:161325119-161325141 TGCCCAGTACATCTTCCCAGAGG + Intergenic
1018692601 6:166360752-166360774 TGCCCTCTCCACATTCCCAGGGG + Intergenic
1019481235 7:1267706-1267728 GGCCCACTCCAGGATGTCAGGGG - Intergenic
1022497137 7:30860267-30860289 GGCGCCCTCCCTGTTTCCAGGGG + Intronic
1025036683 7:55597637-55597659 GGGCAACTCCATGTTCCCCTGGG + Intergenic
1027894786 7:84026691-84026713 GGCCCCATCCATGTTCCTACAGG - Intronic
1029220777 7:98988577-98988599 GGCAGACTGCAGGTTCCCAGGGG + Intronic
1029666152 7:101996483-101996505 GGCCCCCTCCATGGTCACATGGG - Intronic
1030733220 7:113014296-113014318 GGCCCACCCCATGGGCCCAGGGG - Intergenic
1032017192 7:128387819-128387841 GCCCCACTCCGGGTTCCCTGGGG + Intergenic
1032267864 7:130381227-130381249 GGGCCACCCCAGGTCCCCAGCGG + Intronic
1034445971 7:151114656-151114678 GGCCCACACCAGGTGCCCAGAGG + Intronic
1036643436 8:10598068-10598090 GTCCTACTCCATGCACCCAGGGG - Intergenic
1037924764 8:22835514-22835536 GGTCCTGTCCATGTCCCCAGGGG + Intronic
1038420365 8:27430546-27430568 GGACCACTAAATGTACCCAGGGG + Intronic
1040946725 8:52892867-52892889 GGGCAACTCCATCTTCCCACTGG - Intergenic
1040946747 8:52892951-52892973 GGGCCACTCCATCTTCCCGCTGG - Intergenic
1040946775 8:52893072-52893094 GGGCCACTCCATCTTCCCGCTGG - Intergenic
1041916834 8:63146811-63146833 GCTCCAGTCCATGTTCCCTGTGG - Intergenic
1046198212 8:110890489-110890511 GGCCCAGTCCATGATGCCATTGG + Intergenic
1047703416 8:127473197-127473219 AACCCACTCCTTATTCCCAGAGG + Intergenic
1048533782 8:135273997-135274019 GCCCCACTCTTGGTTCCCAGTGG + Intergenic
1049180089 8:141217816-141217838 GGCCCCCACCAAGTTCCCAGAGG + Intronic
1052321729 9:27174721-27174743 GGCTCACTGCATGTTCCGGGGGG - Intronic
1053877842 9:42561877-42561899 GCCCCACTCAATGTCCCCACTGG + Intergenic
1054233853 9:62539817-62539839 GCCCCACTCAATGTCCCCACTGG - Intergenic
1059325887 9:113503785-113503807 GGCCCCCTCCATGGAACCAGCGG - Intronic
1059418893 9:114178916-114178938 TGCCCACCCCAAGTTCCCATGGG + Intronic
1062076347 9:134592075-134592097 GTCCCACTCCCTGCACCCAGAGG + Intergenic
1062291588 9:135797691-135797713 AGCCCACTCCACATTCCAAGTGG + Intergenic
1062613618 9:137386489-137386511 GGGCCACTCCAGATTCCCAGGGG + Intronic
1185767567 X:2738036-2738058 GTTAGACTCCATGTTCCCAGTGG + Intronic
1191008565 X:55737662-55737684 GGTGCACTCCCTGTTCCCATAGG + Intronic
1192183642 X:68931376-68931398 GGCCCACTCCAGTGTCCCAGGGG + Intergenic
1198514282 X:137389130-137389152 GGCCCATTGCATGGTCCCATGGG - Intergenic