ID: 1115522733

View in Genome Browser
Species Human (GRCh38)
Location 14:34249029-34249051
Sequence ACTTTTTAGGGCCTTCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115522729_1115522733 18 Left 1115522729 14:34248988-34249010 CCAGCTCATTCATTCATTCATTT 0: 2
1: 17
2: 115
3: 688
4: 9336
Right 1115522733 14:34249029-34249051 ACTTTTTAGGGCCTTCCTTAGGG 0: 1
1: 0
2: 0
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115522733 Original CRISPR ACTTTTTAGGGCCTTCCTTA GGG Intronic
900672252 1:3861979-3862001 ACTTTTTAGTGGATTCCTTAGGG - Intronic
901178903 1:7326194-7326216 AATTTTGAGAGCCTTCTTTAAGG + Intronic
902159164 1:14515627-14515649 CCTGTTTAGGGGCTGCCTTAGGG + Intergenic
907166982 1:52421524-52421546 ATTTTATACTGCCTTCCTTAAGG + Intronic
910217838 1:84860401-84860423 ACTCTGTGGGGCCTTCCTCATGG + Intronic
916416550 1:164597699-164597721 ACTTTTTATGGCCTTCGTTTTGG + Intronic
919041821 1:192398588-192398610 AGTTTCTATGGCCTTCCTTGGGG + Intergenic
921796872 1:219355708-219355730 ATATTTTATGGCCTTCCATATGG - Intergenic
922236528 1:223726578-223726600 CCCTTTTAGGGCCTCCCTTCTGG + Intronic
922571308 1:226636050-226636072 ACTTTTTGGGGTCTCCCTTAAGG - Intronic
924554266 1:245105173-245105195 AATTTTTATTGCCTTCCTTCAGG + Intronic
1069273228 10:66557294-66557316 ACTTTATTGGGCCTTGTTTATGG - Intronic
1070444390 10:76481400-76481422 CTTTTTTAAGGCCTTCTTTAGGG + Intronic
1073316992 10:102589336-102589358 AATTTTTAGCACATTCCTTAAGG + Intronic
1074947928 10:118299206-118299228 ACTTTTCAGGTTCTTCCTTTGGG + Exonic
1076316083 10:129542648-129542670 ACTTTATAGAGTGTTCCTTAAGG + Intronic
1077879848 11:6340489-6340511 AGTTTTTATGGCTTTCCTTGGGG - Intergenic
1080790667 11:35519872-35519894 ACATTTCAGGGCATGCCTTATGG + Intronic
1081321876 11:41701439-41701461 AATTGTTTGGCCCTTCCTTAAGG + Intergenic
1083280365 11:61623133-61623155 ACTTTCTATGACCTACCTTACGG - Intergenic
1085351603 11:75801393-75801415 ACTTTTCTGTGCCTTCCTGAGGG + Exonic
1086436444 11:86785745-86785767 ATTTTTTAAGGCATTTCTTAAGG - Intergenic
1088765133 11:112967892-112967914 AATTTTGAGGGCCTTCTTTAAGG + Intronic
1092650307 12:10627463-10627485 TGTTTTTAGTCCCTTCCTTAGGG - Intronic
1095392262 12:41721753-41721775 AGTTTCTATGGCCTGCCTTAGGG - Intergenic
1097060668 12:56281089-56281111 ACTCTTTAGGGCCTTCCTGGTGG + Intronic
1099526419 12:83723531-83723553 CCTTTCTAGGACCTTCCTGAAGG + Intergenic
1100931132 12:99610557-99610579 AGTTTCTATGGCCTGCCTTAGGG + Intronic
1100950794 12:99847319-99847341 ATTTTTTATGGCCTGCCTTGGGG - Intronic
1102356414 12:112240288-112240310 ACTTTTCAGAGCCTTCAGTAAGG + Intronic
1105313918 13:19239367-19239389 ACTTTTCAGGGGCTACCTGAGGG - Intergenic
1112408810 13:99144533-99144555 ACTTTTCAAAGCCTTCCTTGGGG + Intergenic
1112977846 13:105342843-105342865 ACATTTTAAGGCCTTTCATATGG + Intergenic
1115522733 14:34249029-34249051 ACTTTTTAGGGCCTTCCTTAGGG + Intronic
1118244009 14:64090473-64090495 ACTTTTGAGGGCCTACTATACGG + Intronic
1124151115 15:27179068-27179090 TCTTTTTGGGGCCTTCATTTTGG + Intronic
1125773751 15:42191876-42191898 ACTTTTTACACCCTTCCTTGTGG - Intronic
1127309093 15:57736269-57736291 ACTTATTAGGACCTACATTAAGG + Intronic
1130266457 15:82409106-82409128 ACTTGTTAAGGTCTACCTTAAGG + Intergenic
1130505567 15:84537776-84537798 ACTTGTTAAGGTCTACCTTAAGG - Intergenic
1131789695 15:95950685-95950707 ACTTTTAAGTGCCTTTCTAATGG - Intergenic
1131835802 15:96389667-96389689 CCTTTTTTGGTCCTTCCTTAAGG - Intergenic
1133866308 16:9646845-9646867 TCTTTTTAGGGTATTCCTCATGG + Intergenic
1135243125 16:20828516-20828538 CCTTTTTTGGGCCATGCTTAAGG - Exonic
1137567451 16:49542445-49542467 TCTTTTCAGGGCCATCCATAGGG - Intronic
1138071000 16:53992881-53992903 TCTTTTTGTGTCCTTCCTTATGG - Intronic
1138768777 16:59636717-59636739 ACTTTGGATGGCCTTCCTGATGG + Intergenic
1149896842 17:60434919-60434941 AGTTTTTAGAGACTTCCTTTTGG - Intergenic
1159266587 18:66088166-66088188 ACTATTTAGGGCCTTTTTTCAGG + Intergenic
1160161411 18:76474327-76474349 AACTTTTAGAGCCTTCCTTGTGG - Intronic
1168413822 19:56156579-56156601 AGTTTTTAAGGCCTGCCTTGTGG + Intronic
926869571 2:17398939-17398961 AATTTTTAAGGCCTACCTTAAGG - Intergenic
927330188 2:21853600-21853622 ATATTTAAGGGCCTTCCTTCGGG - Intergenic
928619332 2:33072574-33072596 AGTTTCTAAGGCCTTCCTTGGGG + Intronic
930846828 2:55915313-55915335 ACTATTAAGTGCCTTGCTTATGG - Intronic
933677814 2:85072917-85072939 ACTTATTTAGGTCTTCCTTAAGG + Intergenic
937705217 2:124912552-124912574 AAGTTTTAGGAACTTCCTTAAGG - Intronic
940107009 2:150112686-150112708 ACTTTTTATTACCTTCATTAAGG + Intergenic
940756774 2:157692327-157692349 ACTTTCTGGGGCCTCCCTAAGGG - Intergenic
945747698 2:213738786-213738808 ACTTTTTAGGGGCTCCATTTGGG + Intronic
946633029 2:221692243-221692265 ACATTTTATGGCCATCCTAATGG - Intergenic
946967963 2:225058495-225058517 ACTTGTTGGGGCTTTCATTAGGG + Intergenic
1179477552 21:41657450-41657472 GCTTTTTAGGGCCATCCTAATGG + Intergenic
1179814499 21:43896332-43896354 ACTTTTTAGGACTTGCCTTATGG + Intronic
953280135 3:41547283-41547305 ACTGTTTTGGTCCTTCCTTTTGG - Intronic
953537909 3:43789955-43789977 ACATCTCAGGGCCTTCTTTAGGG - Intergenic
953542202 3:43831085-43831107 ACTTTTCTGTACCTTCCTTATGG + Intergenic
953595059 3:44303430-44303452 ACTTTTAAGATCCTTCCTTGTGG + Intronic
955067538 3:55545928-55545950 TGTTTTTGGTGCCTTCCTTAGGG + Intronic
966600948 3:181774493-181774515 ACTTTTTATGGCTGTCCTCAGGG + Intergenic
967985996 3:195095702-195095724 ACGTGTTAGGGCCTTACCTAGGG - Intronic
972156865 4:36174048-36174070 GCTTTCTGGGGCCTTCCTGAAGG - Intronic
973977251 4:56274522-56274544 ACTTCTTGGGGTTTTCCTTAAGG + Intronic
974215898 4:58847199-58847221 AGTTTTTAAGACCTTACTTAAGG - Intergenic
976120267 4:81773078-81773100 ATTTTTGAGGTCCTTCCTTCTGG + Intronic
977295542 4:95204942-95204964 CCTTTTTAGGGGCTTCCTCTGGG - Intronic
977563245 4:98555040-98555062 ACATTTCAGGGCCTTGCTTTAGG - Intronic
977993191 4:103469723-103469745 ACTTTTTACAGACTTTCTTATGG - Intergenic
978405512 4:108374557-108374579 ACATTTGAGGGACTTCCATAAGG + Intergenic
980405832 4:132353370-132353392 CCTTTTTAGGACATTCCTGAAGG - Intergenic
981174614 4:141666688-141666710 AGTTTCTATGGCCTTCCTTGGGG - Intronic
982621662 4:157714809-157714831 ACTTTTGAGGGCCTGCAATAAGG + Intergenic
982667773 4:158287870-158287892 ACATTTTAAGGTCTTCCTTTTGG + Intergenic
986691067 5:10314341-10314363 AATTTTTAGGGTCTTCTTTTTGG - Intergenic
986888568 5:12271336-12271358 ATTTTATAGGGCCTTCCTAGGGG - Intergenic
989468639 5:41788219-41788241 ACTTTTTAGTGGCTTCTCTAGGG - Intronic
990056255 5:51583137-51583159 CTTTTTTAGGGCATTCCCTAAGG + Intergenic
990834750 5:60004785-60004807 ACTTTTTATGACCATCCTAATGG - Intronic
992527605 5:77628168-77628190 CCTCTTTGGGGCCTTCCCTAAGG - Intergenic
992589007 5:78273793-78273815 ACTTTTTAAGGTCTTGTTTATGG - Intronic
992732980 5:79690681-79690703 TCATTTTAGGGCCTTCTTAAAGG - Intronic
994838899 5:104895191-104895213 AATTTTAAGGGCATTGCTTAAGG + Intergenic
995453037 5:112323639-112323661 ACTTTTTAGGGTCTGGTTTAAGG - Intronic
995846687 5:116501180-116501202 ACTCCTTAGGGACTTCATTAAGG + Intronic
996564082 5:124861730-124861752 ATTTTTTAGGGTCTTCTATAAGG + Intergenic
999554407 5:152724211-152724233 ACTTTGTAGAGCCTTTGTTATGG - Intergenic
1000684688 5:164233981-164234003 ACTTTTTCTGGCTTTGCTTACGG - Intergenic
1003302908 6:4901022-4901044 ACTATCTAGGCCCTGCCTTAAGG + Intronic
1008991223 6:57604359-57604381 ACTTTTTGGTGCATTCTTTAGGG + Intronic
1009179751 6:60502596-60502618 ACTTTTTGGTGCATTCTTTAGGG + Intergenic
1009820861 6:68799239-68799261 ACTTTTTCTTCCCTTCCTTATGG - Intronic
1010238458 6:73594785-73594807 ATTTTTTAGGGCCATACTAAAGG - Exonic
1011453243 6:87518030-87518052 ACTTTTTAAGGCATACCTTTGGG + Intronic
1012374033 6:98539343-98539365 AATTTTTAGGGTCTCCCTTTTGG - Intergenic
1012507009 6:99958853-99958875 ACTTTCAAGGGGCTTCCTTGGGG + Intronic
1012785314 6:103617621-103617643 ATTTTCTTTGGCCTTCCTTAAGG + Intergenic
1015475807 6:133657903-133657925 CCTTTTTAGGACATTCCTGAAGG + Intergenic
1016636025 6:146291405-146291427 ACTTTGTAAAGCCTTCCTTGAGG + Intronic
1020555601 7:9665603-9665625 GCTTTAAAAGGCCTTCCTTATGG - Intergenic
1024251014 7:47505646-47505668 ACTTTTTAAAGTCTTCATTATGG - Intronic
1026706105 7:72694521-72694543 ACTTTTTAGAGACTTCTTCAAGG - Intronic
1027951032 7:84816160-84816182 ATTTTATAGTGCTTTCCTTAAGG - Intergenic
1028728801 7:94121100-94121122 ACTTTTTATGGCCTTTATGATGG - Intergenic
1030525588 7:110650062-110650084 ACTTTTTGGGGACTTACTAAGGG - Intergenic
1032150595 7:129426359-129426381 ACTTTTTAAGGCCTAGCTTGGGG + Intronic
1032727633 7:134605779-134605801 ACTTCTTAGGGGATTCCTCATGG - Intergenic
1032761762 7:134950066-134950088 ATTTTTTAGGGCTTTCGTGAGGG - Intronic
1036909621 8:12745151-12745173 ACTTTTTAGGACCTCCTTTAGGG - Intronic
1037448660 8:18994786-18994808 ACTTTTTAGGATCTTCTGTATGG - Intronic
1037717468 8:21412205-21412227 ACTCCTTATGTCCTTCCTTAGGG - Intergenic
1039338199 8:36618143-36618165 ACTTTTTGGTGGCGTCCTTAGGG + Intergenic
1042487415 8:69361694-69361716 ATTTTCTATGGCCTGCCTTAGGG + Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1042934940 8:74048942-74048964 ACTTTTCTGAGCCTCCCTTACGG - Intergenic
1047080692 8:121456601-121456623 CCTTTTTATGGCTTTTCTTATGG + Intergenic
1047871124 8:129083312-129083334 ACATTTTAGGGCTCTCCCTAGGG + Intergenic
1048117076 8:131535518-131535540 AAGTTTTAGGTCCTTTCTTAAGG + Intergenic
1048151599 8:131900497-131900519 ACAATTTGGTGCCTTCCTTAAGG - Intergenic
1051454346 9:17237054-17237076 ACTTTAAAGGGCCTTATTTATGG + Intronic
1053079804 9:35165844-35165866 ACTTTTTTTGGGCTTCCATAGGG + Intronic
1056765619 9:89442947-89442969 ACTTTTAAGGGCCTTCACTGGGG + Intronic
1058045705 9:100354449-100354471 CCTTTCTAGGGCCTTCCCTTAGG + Intergenic
1058347032 9:103976470-103976492 TCTTTCTAGGGCCTTCCTAAAGG - Intergenic
1187475833 X:19610016-19610038 ACCCCTTAGGGTCTTCCTTAGGG + Intronic
1187930870 X:24292511-24292533 ACTTTCTCGGTCCTTCCTTTTGG - Intergenic
1188003350 X:25002092-25002114 ACTTTCTAGGGCCTTACTGGAGG - Intergenic
1195593631 X:106662230-106662252 AGTTTTGGGGGCCTTCCTTCTGG - Exonic
1197628928 X:128835415-128835437 CCTTTTTCGTGCCTTCCTTCTGG + Intergenic
1202364389 Y:24146852-24146874 ACTTGTTAAGGTCTACCTTAAGG + Intergenic
1202506392 Y:25523270-25523292 ACTTGTTAAGGTCTACCTTAAGG - Intergenic