ID: 1115529365

View in Genome Browser
Species Human (GRCh38)
Location 14:34312808-34312830
Sequence AAGAAGAAGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7471
Summary {0: 18, 1: 73, 2: 370, 3: 1367, 4: 5643}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115529365_1115529369 -7 Left 1115529365 14:34312808-34312830 CCCTTCTCCTTCTCCTTCTTCTT 0: 18
1: 73
2: 370
3: 1367
4: 5643
Right 1115529369 14:34312824-34312846 TCTTCTTCTTCTTCTTCGAGTGG 0: 1
1: 2
2: 17
3: 75
4: 493
1115529365_1115529370 -6 Left 1115529365 14:34312808-34312830 CCCTTCTCCTTCTCCTTCTTCTT 0: 18
1: 73
2: 370
3: 1367
4: 5643
Right 1115529370 14:34312825-34312847 CTTCTTCTTCTTCTTCGAGTGGG 0: 1
1: 1
2: 11
3: 107
4: 564
1115529365_1115529372 17 Left 1115529365 14:34312808-34312830 CCCTTCTCCTTCTCCTTCTTCTT 0: 18
1: 73
2: 370
3: 1367
4: 5643
Right 1115529372 14:34312848-34312870 TTTCACCATGTTGCCCAGGCTGG 0: 9194
1: 113135
2: 189235
3: 228006
4: 255846
1115529365_1115529371 13 Left 1115529365 14:34312808-34312830 CCCTTCTCCTTCTCCTTCTTCTT 0: 18
1: 73
2: 370
3: 1367
4: 5643
Right 1115529371 14:34312844-34312866 TGGGTTTCACCATGTTGCCCAGG 0: 277
1: 11529
2: 125439
3: 203811
4: 234802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115529365 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG (reversed) Intronic
Too many off-targets to display for this crispr