ID: 1115530156

View in Genome Browser
Species Human (GRCh38)
Location 14:34319635-34319657
Sequence CAGATCTATCTCCTTTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115530153_1115530156 0 Left 1115530153 14:34319612-34319634 CCTTGCTTGAAAATATGCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1115530156 14:34319635-34319657 CAGATCTATCTCCTTTAATGTGG 0: 1
1: 0
2: 1
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115530156 Original CRISPR CAGATCTATCTCCTTTAATG TGG Intronic
906003766 1:42450204-42450226 CAAATCTCTTTCCTTTCATGTGG + Intronic
918807857 1:189072633-189072655 CAAACCTATCTCCTCTCATGAGG - Intergenic
919209798 1:194466545-194466567 CAGATCTATTTCATTTAACAAGG + Intergenic
919317160 1:195986423-195986445 CACATCTATTACCTTTATTGTGG + Intergenic
919325440 1:196100764-196100786 AAGCTGTATCTGCTTTAATGGGG - Intergenic
921486735 1:215723631-215723653 CAGAACCTTCTCCATTAATGAGG - Intronic
922579456 1:226686163-226686185 CAGTTCTGTCTGCTCTAATGAGG + Intronic
1069792173 10:71029903-71029925 CACCTCTCTCTCCATTAATGAGG + Intergenic
1070438432 10:76416378-76416400 CAGATCTATCACTTATAATGCGG + Intronic
1071810392 10:89173991-89174013 CAGACCAATCTATTTTAATGTGG + Intergenic
1072354141 10:94589503-94589525 CACCTCTATCTCCTATAATATGG - Intronic
1077129797 11:965451-965473 GTGATCTTTATCCTTTAATGAGG + Intronic
1083252994 11:61480503-61480525 CTGATCTGTCACCTTTGATGAGG - Intronic
1085499208 11:77003081-77003103 CAGATCTATATACTTTAAAAGGG + Intronic
1087583768 11:100092655-100092677 CAGATATAACAGCTTTAATGTGG - Intronic
1090215282 11:124956814-124956836 CAGAGCTATATCCGTTAATAAGG - Intronic
1090303579 11:125670492-125670514 TAGGTCTGTCTCCTTCAATGTGG + Intronic
1091214148 11:133890204-133890226 CACATCTATTTCATTTCATGTGG + Intergenic
1093232521 12:16564760-16564782 CATATTTATCTCATTAAATGAGG - Intronic
1095935846 12:47679989-47680011 CAGTTTTATCACCTTTAAAGTGG - Intronic
1096184662 12:49570797-49570819 CAGAGCTATCCCCTCTGATGGGG - Intronic
1098283770 12:68887358-68887380 CAGATCTAGCTCTTTAAATCAGG + Intronic
1099420711 12:82456274-82456296 CAGATCCATCTCATTATATGGGG + Intronic
1100559405 12:95733042-95733064 CAGATTTTTCTCCTGTAATTTGG - Intronic
1101024337 12:100585760-100585782 CAGATCCATCTCCTTTCCAGTGG + Intronic
1105275824 13:18924839-18924861 CAGATCTACCTTTTTTAATGAGG + Intergenic
1110952596 13:81515218-81515240 CAGATCTTTGCCCTTTAATTTGG - Intergenic
1114246744 14:20921476-20921498 CAGACCTATTTCCTTTAAATGGG + Intergenic
1115530156 14:34319635-34319657 CAGATCTATCTCCTTTAATGTGG + Intronic
1118429761 14:65705327-65705349 CAGATCTCTGTCATTAAATGAGG + Intronic
1119012818 14:71013854-71013876 CAGTTCTATCTCCTTAACTCAGG - Intronic
1119170288 14:72529704-72529726 CAGATCTTTCCACTTTGATGAGG + Intronic
1119459042 14:74782890-74782912 CAGAAGTATCTCCTTAACTGGGG - Intronic
1125335196 15:38619783-38619805 CAGATAGATCTCCTTTAAACTGG + Intergenic
1127580094 15:60330479-60330501 CATATATATCTTCTTTATTGAGG - Intergenic
1129497536 15:75999694-75999716 CAGATTTATCTTTTTTAATATGG - Intronic
1131492155 15:92872584-92872606 CAGATCTATCTCCTCCATTTAGG + Intergenic
1131805917 15:96122382-96122404 CAGGTCTATCTTATTTACTGAGG - Intergenic
1134019287 16:10910329-10910351 GAGATCTATCTCCATTCAGGTGG - Intronic
1137542667 16:49375888-49375910 CAGGTCTATCTCCTTTTACCAGG + Intronic
1143237179 17:5412828-5412850 CAAATCTAACTCCTTCAGTGTGG - Intronic
1145203517 17:20968148-20968170 CAGATCTGTCTCGTTAACTGTGG + Intergenic
1148525231 17:48326220-48326242 CAGAACTGTCTCCATAAATGGGG + Intronic
1149558647 17:57592634-57592656 CCGGGCTATCTCCTTTAATCAGG + Intronic
1150747813 17:67830550-67830572 CACATCAATCCCCTTAAATGGGG - Intronic
1154467442 18:14661979-14662001 CAGATCTACCTTTTTTAATGAGG + Intergenic
1159889309 18:73939379-73939401 CAGATCCATCTCCTTAGCTGGGG + Intergenic
1160279834 18:77478662-77478684 CAGATCTACCCCCTTGGATGTGG + Intergenic
1163201951 19:15776089-15776111 CAGATCCATCTCCTCAAGTGTGG + Intergenic
1165424870 19:35740154-35740176 CAACTTTATATCCTTTAATGGGG + Intronic
930760926 2:55035003-55035025 CAGATTTATCTCCTCTGTTGGGG - Intronic
931856981 2:66313129-66313151 CAGGGCTTTTTCCTTTAATGAGG - Intergenic
932521522 2:72419392-72419414 CAGATCTTTCTTTCTTAATGAGG + Intronic
934912876 2:98275373-98275395 CAAATCTATCTCCTTAACTCTGG - Intronic
935033907 2:99349162-99349184 GAGGTCTATCTCCTTTAATGTGG - Intronic
935041707 2:99436613-99436635 CACCTTTATCTCCTTAAATGTGG - Intronic
935398018 2:102629473-102629495 CAGATCTATGTGGTTTAATGAGG - Intronic
939831773 2:147080925-147080947 CAGATCTACCTCCTTATACGTGG - Intergenic
940488366 2:154325367-154325389 CCGATCTAGTTCCTTTAATGTGG - Intronic
941461102 2:165772988-165773010 AATATCTATCACCTTTACTGGGG - Intronic
945006228 2:205410272-205410294 CAGATAAATTTACTTTAATGGGG + Intronic
946143072 2:217707907-217707929 CAGATATTTCTTCTTTAATAAGG - Intronic
948962114 2:241347513-241347535 CAGATCCTGCTCCTTAAATGTGG + Intronic
1169346805 20:4835324-4835346 CAGATGTCACTCCTTTTATGAGG - Intergenic
1172347306 20:34212619-34212641 CAGTACAATCTCCTTTAATCTGG + Intronic
1173111135 20:40191645-40191667 CAGAGTTATCTCCTCGAATGTGG - Intergenic
1175689578 20:61055936-61055958 GAGATCTATCTCCTGCAATAGGG + Intergenic
1176292642 21:5054372-5054394 TAGACCTTTCTCCTTTGATGTGG + Intergenic
1176807070 21:13495700-13495722 CAGATCTACCTTTTTTAATGAGG - Intergenic
1177919488 21:27133151-27133173 AAGATCAATCACCTTAAATGTGG - Intergenic
1178271015 21:31189893-31189915 CAGATCTATTTCTTTTAAATAGG + Intronic
1179864618 21:44209278-44209300 TAGACCTTTCTCCTTTGATGTGG - Intergenic
1181683685 22:24514186-24514208 CAGTTCTCTCTCCATGAATGTGG + Intronic
1183767539 22:39893110-39893132 CTCATCTCTCTCCTTTAATTAGG + Intronic
1184604551 22:45564721-45564743 CAGGTCTATCTCATTCAGTGCGG + Intronic
949621999 3:5823644-5823666 CAGATCTATCTCGTGTACTATGG + Intergenic
950978715 3:17278649-17278671 CAGATCTATGTCTCTTTATGAGG - Intronic
951268527 3:20598199-20598221 CAGATCCTTCTCCTGTGATGTGG + Intergenic
952162831 3:30712221-30712243 CAGATGTATCTCCCTTTTTGAGG - Intergenic
952249826 3:31641796-31641818 CTGATTTTTCTCCTTTAATGTGG + Intergenic
953209157 3:40858981-40859003 CTGTGCTATCTCCTTTAAAGAGG - Intergenic
953505765 3:43484428-43484450 TAGAGATATCTCCATTAATGTGG - Intronic
956903483 3:73741324-73741346 CAGATCTATTCCCCTTCATGTGG + Intergenic
960070839 3:113428274-113428296 CAGTTCTAACTCCTTTCCTGGGG - Intronic
960349070 3:116571986-116572008 CACATCTATCTCCATAAAGGAGG - Intronic
960447710 3:117767870-117767892 CTGATCTTTTTCCTATAATGAGG + Intergenic
966143322 3:176781893-176781915 CAAGTGTATCTCCTTTAATTTGG + Intergenic
969892472 4:10272490-10272512 CAGAGCTCGCTCCTTTGATGTGG + Intergenic
970457307 4:16237956-16237978 CATATCTTTCTCCGTTCATGAGG - Intergenic
972700043 4:41485551-41485573 CATATATATCTCCATTAAAGGGG - Intronic
973123289 4:46550982-46551004 AAGATCTATCTCTTTTATTTTGG - Intergenic
974893124 4:67906521-67906543 AAGCTCTATCTGCTTTAAGGGGG + Intergenic
975374609 4:73629545-73629567 GGGATCTTTCTTCTTTAATGTGG + Intergenic
976710316 4:88063725-88063747 CAGGTCTATCAACTTAAATGAGG + Intronic
978901424 4:113954579-113954601 CACATCTATCTCCCTTAACTTGG + Intronic
979563575 4:122128021-122128043 CACATCCATCTCCTTCCATGAGG + Intergenic
981616954 4:146652428-146652450 GAGATCTAACTCTTTTAATGAGG + Intergenic
982338223 4:154264757-154264779 TTGAACTATCTCCTTTAGTGAGG - Intronic
982853516 4:160350182-160350204 CAGAACTTTCTGCTATAATGTGG + Intergenic
989612516 5:43308901-43308923 AAGATCTATTTCTTTTTATGGGG - Intronic
990203018 5:53398964-53398986 CTTCTCTATCTCATTTAATGTGG + Intergenic
990549472 5:56859729-56859751 CAGATCCATCTCCTTTAACTGGG - Exonic
991668117 5:69020378-69020400 CATATGAATCTCCTTAAATGTGG + Intergenic
992523487 5:77581880-77581902 GAGACCTTTCTTCTTTAATGTGG - Intronic
994706148 5:103208811-103208833 CAGCTCTATCTCCTATTTTGGGG + Intronic
995748125 5:115425246-115425268 CAGCTGTAGCTCCTTTAGTGAGG - Intergenic
997068547 5:130592020-130592042 CAGTTCTATATCTTTTAATTTGG - Intergenic
998326109 5:141281252-141281274 CAGATATATTTCCTTTCAGGAGG - Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1001768015 5:174269669-174269691 CAGATTTTTTTCCTTGAATGTGG - Intergenic
1002152724 5:177248688-177248710 GAGATGTTTTTCCTTTAATGTGG + Intronic
1004804058 6:19182659-19182681 CAGATCTCTCTCCTTTACTCTGG - Intergenic
1005321708 6:24662190-24662212 CAGATCTTTCTCTTCTCATGAGG - Intronic
1008147868 6:47913332-47913354 CATATTTATTTCCTCTAATGAGG + Intronic
1014558330 6:122860282-122860304 CAGACCTATATGCTTTATTGTGG + Intergenic
1015885599 6:137915083-137915105 CCAATCTATCTTCTTTACTGAGG + Intergenic
1016773916 6:147882771-147882793 AAGATCTATATCTTTTAATGTGG - Intergenic
1020398801 7:7750341-7750363 CATATCTATCTCTGATAATGAGG - Intronic
1021624799 7:22582716-22582738 CAAATCTATCTCCTTGATTTGGG + Intronic
1022877184 7:34546133-34546155 GAGATCTTTCTTCTTTATTGAGG + Intergenic
1024365037 7:48510522-48510544 CATATCCATCTCCTTTGAGGAGG - Intronic
1024634648 7:51276947-51276969 CAGATGCATCTCCTTTTCTGTGG - Intronic
1030785235 7:113652348-113652370 TAGATCTATTTCCTTGATTGTGG - Intergenic
1031177077 7:118367040-118367062 CACATCTTTTTCCTATAATGAGG + Intergenic
1031190908 7:118549528-118549550 CACATCCATTTCCTTTAAAGTGG - Intergenic
1031804903 7:126295974-126295996 CATCTCTAACTCCTTTTATGAGG + Intergenic
1032207316 7:129878930-129878952 CAGATCTATCTGATTGAAGGTGG - Intronic
1032262941 7:130351252-130351274 CAGTTCTATTTCTTTTGATGTGG - Intronic
1033557134 7:142498706-142498728 CAGATCAATGCCCTTTATTGTGG + Intergenic
1033818394 7:145103176-145103198 CAGATCTATCTCCTCAACTCAGG - Intergenic
1036605626 8:10303179-10303201 CGGGTCTGTGTCCTTTAATGTGG + Intronic
1036806132 8:11835202-11835224 CAGATGTAACTCCTTGATTGAGG + Intronic
1037043788 8:14271677-14271699 CAGATCAACCTCCTTGACTGGGG + Intronic
1037326416 8:17695692-17695714 CAGAACTATTTTTTTTAATGAGG + Intronic
1040659374 8:49552461-49552483 CAGCTCTATCTCCTCAAATCAGG + Intronic
1041203037 8:55470055-55470077 CAGCTCTATCTGATGTAATGGGG + Intronic
1041984473 8:63905515-63905537 CAGATGTATCTAATTTGATGGGG - Intergenic
1047802191 8:128321534-128321556 CAAATCTATCTCCTTTGCTAAGG - Intergenic
1048033181 8:130652142-130652164 CAGATCTCTCACCTTAAAAGGGG - Intergenic
1049128352 8:140812571-140812593 CAGCTCTGTGTCTTTTAATGGGG - Intronic
1050775869 9:9259557-9259579 CAGATGTACTTCCTTTAATTTGG - Intronic
1050896725 9:10891942-10891964 CAGATCTACTTCCTTTTATAGGG - Intergenic
1054941450 9:70747036-70747058 CAGATGTATATACATTAATGGGG - Intronic
1055474064 9:76643892-76643914 CAGTTCTCTCTTCCTTAATGAGG - Intronic
1055940638 9:81645910-81645932 CAGGTGTAACTCCTATAATGGGG + Intronic
1057319528 9:93999755-93999777 CAGATGTAACGCCTTTATTGGGG - Intergenic
1057986290 9:99717888-99717910 TATTTCTATCTCCATTAATGTGG + Intergenic
1058190828 9:101912874-101912896 CTGATCTCTCTCATTTAATGAGG + Intergenic
1059475796 9:114546697-114546719 CAAATCTCTCCCCTTGAATGAGG - Intergenic
1060442622 9:123655857-123655879 CATTTCTATCTCCTATAATCAGG + Intronic
1196602026 X:117612614-117612636 CAAAACTATCTCCTATTATGGGG + Intergenic
1201798369 Y:17926219-17926241 CAGATTTATTTCCTATAATCTGG - Intergenic
1201803184 Y:17979738-17979760 CAGATTTATTTCCTATAATCTGG + Intergenic
1202359689 Y:24094908-24094930 CAGATTTATTTCCTATAATCTGG - Intergenic
1202511089 Y:25575206-25575228 CAGATTTATTTCCTATAATCTGG + Intergenic