ID: 1115530292

View in Genome Browser
Species Human (GRCh38)
Location 14:34320864-34320886
Sequence GCTCATTTAAGAGCCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115530288_1115530292 12 Left 1115530288 14:34320829-34320851 CCTGTCACAAGGTTGTAATCAAG 0: 1
1: 0
2: 1
3: 14
4: 94
Right 1115530292 14:34320864-34320886 GCTCATTTAAGAGCCCAGACTGG 0: 1
1: 0
2: 2
3: 16
4: 122
1115530286_1115530292 26 Left 1115530286 14:34320815-34320837 CCTCTGCTTCATGGCCTGTCACA 0: 1
1: 0
2: 3
3: 47
4: 299
Right 1115530292 14:34320864-34320886 GCTCATTTAAGAGCCCAGACTGG 0: 1
1: 0
2: 2
3: 16
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115530292 Original CRISPR GCTCATTTAAGAGCCCAGAC TGG Intronic
901216863 1:7559922-7559944 TCTCATCCAAGAACCCAGACAGG - Intronic
906082749 1:43104382-43104404 GCTCATTAGAGAACCCATACTGG + Intergenic
907759692 1:57345122-57345144 GCCCATTTCAGAGTCCAAACTGG - Intronic
908764594 1:67543021-67543043 CCTCATTTAATAGCCCAGACTGG - Intergenic
912310721 1:108618338-108618360 GCTCATTGAAGAGCAAGGACAGG + Intronic
915007066 1:152648081-152648103 GCTCATTTCTGAGCCCAGCCTGG + Intergenic
916412964 1:164565048-164565070 GTACATTTAAGTGCCCTGACAGG - Intronic
919676044 1:200384594-200384616 GATCACTTAAGAGACCAGCCTGG - Intergenic
920719015 1:208369662-208369684 CCCCATTTAATAGCACAGACAGG + Intergenic
921491320 1:215779671-215779693 GCTAATAGAAGAGCCCACACTGG - Intronic
921541133 1:216417371-216417393 GCTCATATGAGAGCTCATACTGG + Intronic
1066332285 10:34437591-34437613 GTTAATTTAAGACCCCAAACTGG - Intronic
1068537781 10:58259241-58259263 GCTCATTTCAGGGCCGAGACAGG + Intronic
1069529942 10:69210057-69210079 GCTCAATTCACAGCCCAGACTGG - Intergenic
1070270335 10:74947922-74947944 GCTCATGTAAGTGCCCAGGGTGG + Intronic
1073556305 10:104455668-104455690 CCTCATTTAAGAGTGGAGACTGG - Intergenic
1074132555 10:110594044-110594066 GTTCAATTAAGAGTCCAGACAGG + Intronic
1075850980 10:125586759-125586781 TCTCATTTTGGAGCCCAGACTGG - Intronic
1077589490 11:3480586-3480608 GCTCGTTTAAGACCCAAAACGGG - Intergenic
1078564062 11:12398427-12398449 GCTATTGTAAGAGCCCTGACTGG + Intronic
1084245211 11:67852360-67852382 GCTCGTTTAAGACCCAAAACGGG - Intergenic
1084827477 11:71742218-71742240 GCTCGTTTAAGACCCAAAACGGG + Intergenic
1089519250 11:119052756-119052778 GCTCATTGAAAAGCCCAGCCAGG + Exonic
1092435499 12:8443706-8443728 GCTCGTTTAAGACCCAAAACGGG - Intergenic
1096802560 12:54120902-54120924 TCTCATTTTGTAGCCCAGACTGG + Intergenic
1100443691 12:94641435-94641457 GCCAATTTGAGAGCCCAGCCGGG - Intronic
1101023338 12:100574759-100574781 AATCATTTAAGTGCCAAGACAGG - Intronic
1104156420 12:126137040-126137062 GCTCCATGATGAGCCCAGACAGG + Intergenic
1104641974 12:130473259-130473281 GCTCATTTAGGGGCCAACACAGG + Intronic
1104935626 12:132362791-132362813 ACTCCTTTGAGAGCTCAGACTGG + Intergenic
1105005740 12:132719520-132719542 GCTCATTCACAAGCACAGACAGG - Intronic
1105072366 12:133242526-133242548 CCTCCTCTCAGAGCCCAGACCGG - Intergenic
1108717770 13:53098679-53098701 GCACAGTTAAGAGAACAGACAGG + Intergenic
1109260133 13:60135604-60135626 GCAAATTCAAGAGTCCAGACGGG + Intronic
1115357219 14:32461155-32461177 GCTCATTTCAGAGAACAGGCAGG - Intronic
1115530292 14:34320864-34320886 GCTCATTTAAGAGCCCAGACTGG + Intronic
1117090389 14:52244199-52244221 GGACAGCTAAGAGCCCAGACAGG + Intergenic
1118000096 14:61514828-61514850 AGTCATATAACAGCCCAGACGGG + Intronic
1119859809 14:77927997-77928019 GATCATTTAGGAGCCTAGGCCGG + Intronic
1125543181 15:40484109-40484131 GCTCTGTTAACAGCCCAGGCTGG + Intergenic
1127829373 15:62737017-62737039 GCTCATTCAAGAGGCCAAGCAGG + Exonic
1130118266 15:81024403-81024425 GCTCATTAGGGAGCACAGACTGG + Intronic
1133107624 16:3523518-3523540 GGTCAGTTAAGAGAACAGACAGG + Intronic
1134541252 16:15067785-15067807 TCTCATTCTGGAGCCCAGACTGG + Intronic
1135436710 16:22432340-22432362 TCTCATTCTGGAGCCCAGACTGG + Intronic
1136263549 16:29099577-29099599 TCTCATTCTGGAGCCCAGACTGG - Intergenic
1138094001 16:54197989-54198011 GCTCTTCCAAGAGCCCAGACAGG + Intergenic
1140754991 16:78059004-78059026 GCTCGTTTAAGACCCAAAACTGG - Intronic
1146989513 17:37255630-37255652 ACTCATTTATGTTCCCAGACTGG - Intronic
1147518585 17:41146074-41146096 GCCAGTTTCAGAGCCCAGACAGG - Intergenic
1148066544 17:44875067-44875089 GCTGATTCTAGAGCCCAGGCTGG + Intronic
1149755656 17:59183315-59183337 GCCCATTTCAGAGTCCAGTCTGG + Intronic
1156250498 18:35347652-35347674 TCTCATTTAGGAGCCCTTACAGG - Intergenic
1157297900 18:46459229-46459251 TGTCAGTGAAGAGCCCAGACTGG - Exonic
1161321666 19:3644293-3644315 GCTCATAGCAAAGCCCAGACAGG + Intronic
1162253461 19:9466992-9467014 GATCATTTAAGAACTCACACTGG - Exonic
1162253491 19:9467412-9467434 GCTCATTTGAGAACTCACACTGG - Exonic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1163916536 19:20245245-20245267 GCTCATTTAGGACCTAAGACTGG + Intergenic
1163966844 19:20753992-20754014 GCTCATTTAAGACCCAAAACAGG - Intronic
1164329553 19:24240566-24240588 GGACATTTAAGAGCCCATAGAGG - Intergenic
1164329565 19:24240738-24240760 GGACATTTAAGAGCCCATAGAGG - Intergenic
1164330909 19:24254807-24254829 GGACATTTAAGAGCCCATAGAGG - Intergenic
1164331549 19:24263440-24263462 GGACATTTAAGAGCCCACAGAGG - Intergenic
1164362310 19:27527545-27527567 GGACATTTAAGAGCCCATAAAGG + Intergenic
1164745349 19:30608564-30608586 GCTCATTCTAGGTCCCAGACTGG - Intronic
1168669118 19:58228116-58228138 CCTCATTGAAGAGCCAGGACGGG + Intergenic
925871779 2:8278050-8278072 GCTCATCTCAGGGCTCAGACAGG + Intergenic
926256119 2:11201647-11201669 TCTCATTTAATAGCACAGATAGG + Intronic
928415356 2:31087197-31087219 GGTCATTCAACAGCCCACACTGG - Intronic
939698631 2:145360651-145360673 GCTCATTTAAGTTCCCAGACTGG + Intergenic
945663529 2:212715003-212715025 CCTTTTTTAAGAGCCCAGACTGG - Intergenic
946964145 2:225019234-225019256 ACTCATTCAAGATCCCACACAGG - Intronic
947716572 2:232342767-232342789 GCTCATGTGTGAGCCCAGGCTGG + Intronic
1171407409 20:24920851-24920873 GCTCATTTAAGACCCAAAACTGG + Intergenic
1171794186 20:29553685-29553707 TCTCATTTTGTAGCCCAGACTGG - Intergenic
1175525836 20:59632752-59632774 GCTCATGAAAGTGCCCAGGCTGG + Intronic
1179048640 21:37869763-37869785 GCTCCTTTAAGAGGCCAGCCTGG + Intronic
1179728069 21:43351525-43351547 GCTGATTTCAGAGCCAAGATAGG + Intergenic
1183714206 22:39524222-39524244 GCAAAATGAAGAGCCCAGACTGG - Intergenic
950284381 3:11733297-11733319 GCTCTTTTAAGAACTCACACAGG - Intergenic
955769187 3:62372274-62372296 GCGCATTGAGGAGGCCAGACGGG + Exonic
960254286 3:115495075-115495097 GCTAATGTAAGAGTGCAGACAGG - Intergenic
961893325 3:130148105-130148127 GCTCATTTAAGACCCAAAACGGG - Intergenic
970362068 4:15320175-15320197 TCTCATTTAAAAGCTCAGAGAGG + Intergenic
974207017 4:58718414-58718436 CCTCATTTAATAGCACAGAAAGG - Intergenic
980203011 4:129679609-129679631 GCTCATTTAAGAGCTTTCACTGG - Intergenic
980526442 4:133995395-133995417 GCTCATGTAAGTCCCCAGACTGG + Intergenic
981518596 4:145636619-145636641 GCACATTTAAGTCCTCAGACTGG + Intronic
982010908 4:151105507-151105529 TCTCATTTTGTAGCCCAGACTGG - Intronic
983488005 4:168353974-168353996 GCTCTATGATGAGCCCAGACAGG + Intergenic
985666476 5:1183906-1183928 CCCCATTTAGCAGCCCAGACTGG - Intergenic
988136334 5:27176001-27176023 GTTCATTTAGTTGCCCAGACTGG + Intergenic
991568984 5:68034776-68034798 GGTCATTTAAGCCCCCAGACAGG - Intergenic
995765064 5:115605431-115605453 GATGATTTAGGAGCCGAGACTGG + Intronic
997255650 5:132426179-132426201 TCTCATTCCAGAGCCCACACTGG + Intronic
998560697 5:143169107-143169129 GCTCCTGTTAGAGCCCAGAGAGG - Intronic
998942804 5:147303292-147303314 ACTCACATAACAGCCCAGACTGG - Intronic
999147012 5:149403112-149403134 TCTCATTCTATAGCCCAGACTGG + Intronic
1002094388 5:176822610-176822632 CCACATTTGAGAGCCCAGACAGG + Intronic
1002887904 6:1312311-1312333 GCTCGTTAAAGAGCCCAGGAGGG - Intergenic
1007994668 6:46293742-46293764 GCTCAGGTAAGAGCACAGAAAGG + Intronic
1008120524 6:47610900-47610922 GCTAATTTAAGAGCACCTACAGG - Intronic
1014132247 6:117847331-117847353 GCCCATTTAAGAACCCATGCTGG - Intergenic
1015843881 6:137497910-137497932 GCTCTTCTCAGAGCCAAGACAGG - Intergenic
1018871489 6:167787052-167787074 GCTCAATTAAGAGACAAAACAGG - Intronic
1020045658 7:5038277-5038299 GCCCATTTCAGAGTCCAGTCTGG + Intronic
1020291059 7:6722476-6722498 GCCCATTTCAGAGTCCAGTCTGG + Intergenic
1020414580 7:7931178-7931200 GCTCATTATATTGCCCAGACTGG + Intronic
1023045563 7:36207442-36207464 GTCCATTTTAGACCCCAGACAGG + Intronic
1023824422 7:43999524-43999546 GCCCATTTCAGAGTCCAGTCTGG - Intergenic
1025534770 7:61934065-61934087 GGTCATTTAGGAGCCCATAGGGG + Intergenic
1026087970 7:67278288-67278310 GCCCATTTCAGAGTCCAGGCTGG - Intergenic
1027117574 7:75493623-75493645 GCCCATTTCAGAGTCCAGTCTGG - Intergenic
1027274231 7:76541862-76541884 GCCCATTTCAGAGTCCAGGCTGG + Intergenic
1027327673 7:77060915-77060937 GCCCATTTCAGAGTCCAGTCTGG + Intergenic
1029719926 7:102356426-102356448 GCCCATTTCAGAGTCCAGTCTGG + Intergenic
1029752687 7:102552831-102552853 GCCCATTTCAGAGTCCAGTCTGG - Exonic
1029770638 7:102651924-102651946 GCCCATTTCAGAGTCCAGTCTGG - Exonic
1029956741 7:104648319-104648341 GCTCATTGGAGAGCTCAGAGAGG - Intronic
1032008392 7:128323426-128323448 GCTCATCAAAGAGCCCAGTATGG - Intronic
1035945582 8:3957652-3957674 GCTCTGTTAATAGCCCAGGCTGG - Intronic
1036372511 8:8173381-8173403 GCTCGTTTAAGACCCAAAACGGG + Intergenic
1036878392 8:12492260-12492282 GCTCGTTTAAGACCCAAAACGGG - Intergenic
1037556009 8:20023283-20023305 TCTCTTCTAAGAGCCAAGACAGG - Intergenic
1038798623 8:30730185-30730207 GCTCGTTTAAGACCCAAAACGGG + Intergenic
1041102991 8:54415442-54415464 CCACATTTAAGATCCCAGCCAGG + Intergenic
1048402229 8:134082884-134082906 GCTCCTTTACAAGCCCAGAAGGG - Intergenic
1053792095 9:41693982-41694004 TCTCATTTTGTAGCCCAGACTGG + Intergenic
1054180502 9:61906002-61906024 TCTCATTTTGTAGCCCAGACTGG + Intergenic
1054472853 9:65551984-65552006 TCTCATTTTGTAGCCCAGACTGG - Intergenic
1054657089 9:67675140-67675162 TCTCATTTTGTAGCCCAGACTGG - Intergenic
1056716233 9:89032333-89032355 GCACATTTAAGAGCACATGCTGG - Intronic
1056906774 9:90658079-90658101 GCTCTTTTTAAAGCCCAGGCTGG + Intergenic
1057726423 9:97571757-97571779 GCTGCTTCAAGAACCCAGACAGG - Intronic
1057862698 9:98654362-98654384 GCTCCTTTAAGAGCCCATAATGG + Intronic
1059845032 9:118265851-118265873 GCTCATTTAACAGCCTAAAAAGG - Intergenic
1062224668 9:135442994-135443016 GCTCGTTTAAGACCCAAAACTGG - Intergenic
1197247870 X:124185081-124185103 GCTCTGTTAACAGCCCAGGCTGG + Intronic
1199860400 X:151796164-151796186 GCTCATTCCATAGCCCAGGCAGG - Intergenic
1200947870 Y:8864356-8864378 GCTCGTTTAAGACCCAAAACTGG + Intergenic