ID: 1115532173

View in Genome Browser
Species Human (GRCh38)
Location 14:34337549-34337571
Sequence TTCCAAATCTCCTGAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115532173_1115532180 22 Left 1115532173 14:34337549-34337571 CCAGCCCCTCAGGAGATTTGGAA 0: 1
1: 0
2: 1
3: 23
4: 178
Right 1115532180 14:34337594-34337616 TCCTAGAAAGTGGCAGAATTAGG 0: 1
1: 1
2: 6
3: 67
4: 527
1115532173_1115532179 12 Left 1115532173 14:34337549-34337571 CCAGCCCCTCAGGAGATTTGGAA 0: 1
1: 0
2: 1
3: 23
4: 178
Right 1115532179 14:34337584-34337606 GCTTCAGAAATCCTAGAAAGTGG 0: 1
1: 0
2: 1
3: 22
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115532173 Original CRISPR TTCCAAATCTCCTGAGGGGC TGG (reversed) Intronic
900096208 1:941138-941160 ACCCAGATCTCCTGAGGGTCCGG + Exonic
901916923 1:12507109-12507131 TTCTCAGGCTCCTGAGGGGCGGG + Intronic
901957293 1:12795808-12795830 TTCAAACTCTCCTCAGGGGCAGG - Exonic
901965312 1:12861591-12861613 TTCAAACTCTCCTCAGGGGCAGG - Exonic
901973692 1:12928065-12928087 TTCAAACTCTCCTCAGGGGCAGG - Intronic
901980705 1:13031942-13031964 TTCAAACTCTCCTCAGGGGCAGG - Exonic
901988729 1:13095340-13095362 TTCAAACTCTCCTCGGGGGCAGG + Intergenic
901993084 1:13131427-13131449 TTCAAACTCTCCTCGGGGGCAGG - Intergenic
902001384 1:13196989-13197011 TTCAAACTCTCCTCAGGGGCAGG + Exonic
902011486 1:13273702-13273724 TTCAAACTCTCCTCAGGGGCAGG + Intergenic
902020620 1:13342694-13342716 TTCAAACTCTCCTCAGGGGCAGG + Exonic
903563415 1:24246083-24246105 TTCCAAAGGTCACGAGGGGCCGG - Intergenic
903607870 1:24588350-24588372 CTCCCAATCTCCTGAGGGATGGG - Intronic
905794402 1:40807516-40807538 TTCCAAGAATCCTCAGGGGCTGG - Intronic
908885744 1:68786448-68786470 GTCCAAATCTACTGAGGGAGAGG + Intergenic
909959208 1:81818057-81818079 TCCCACTTCTCCTGAGTGGCTGG - Intronic
914794093 1:150905622-150905644 TTCCAAATCTCATGAGAAGATGG + Intergenic
916551677 1:165855799-165855821 TTCCAACTCTCCAGAGGGCCAGG - Intronic
918144555 1:181744020-181744042 AGCCAAATCTCCTGAGTGCCAGG - Intronic
918190180 1:182166158-182166180 TGACAAATCTCCAGAGGGACTGG + Intergenic
922531017 1:226345296-226345318 CTCCAAATCTCCTGAGGTCATGG - Intergenic
923148299 1:231213063-231213085 TTCAAAATTTCCTGAAGGCCTGG + Intronic
1063603209 10:7500531-7500553 TTCCACATTTCCTGAGGTGCAGG - Intergenic
1064187316 10:13173741-13173763 TGCCAAAGGTCCTGAGGGGATGG - Intronic
1065917311 10:30364723-30364745 GCCCCAAGCTCCTGAGGGGCTGG + Intronic
1067411529 10:46069036-46069058 TTCCAAGTCCCCTGAGAGGCAGG + Intergenic
1067793184 10:49302781-49302803 TTCCCAAAGTCCTGAGGAGCTGG - Intronic
1070552523 10:77501858-77501880 ATCAAAATGTCCTGTGGGGCAGG + Intronic
1076456665 10:130604770-130604792 TTCCACATATCCTGTGGGGCAGG + Intergenic
1076459631 10:130632764-130632786 TTCCCAATCTCCTCTGGGGAAGG - Intergenic
1077280685 11:1743898-1743920 TTGAAAACCTCGTGAGGGGCTGG - Intronic
1078320563 11:10330941-10330963 TTCCAAGTCTCTGGAGGGCCAGG - Intronic
1080733054 11:34980588-34980610 TTTCAAATCTTCTGAGGGTTTGG + Intronic
1081293037 11:41349953-41349975 TTGCAAATCTCCTCAGTGTCTGG + Intronic
1081597207 11:44467472-44467494 TGCCAGAACCCCTGAGGGGCAGG + Intergenic
1081933728 11:46890204-46890226 TACCAAGGCTCCTGGGGGGCAGG + Intronic
1083850462 11:65363207-65363229 TTCTCAGTCTCCTGAGTGGCTGG + Intergenic
1084017882 11:66397311-66397333 GCCCAAACCTCCTGAGTGGCTGG + Intergenic
1084846856 11:71907536-71907558 TTCAAAATCTCCAGAGGGGGAGG - Intronic
1087266194 11:96064015-96064037 TTCCAAGCCTCCTGATTGGCTGG + Intronic
1087277381 11:96174107-96174129 TTCCACATGGCATGAGGGGCAGG + Intronic
1090275079 11:125413371-125413393 TTCCAAATTGCCTGAGAGCCAGG + Intronic
1091128565 11:133124153-133124175 TTCTAAATTTCCTGAGGGTATGG - Intronic
1091825019 12:3505795-3505817 TTCCAAATCTCCAGGTGGGTAGG - Intronic
1096254705 12:50056024-50056046 TTCCAAATATCCTCAGGGGGAGG - Intergenic
1096694292 12:53338948-53338970 TTCCCAGTGCCCTGAGGGGCTGG + Intronic
1096984003 12:55744651-55744673 TTCCAGCTCTCCTTAGGGTCAGG + Intronic
1097670943 12:62536984-62537006 TTAAAAAACTCATGAGGGGCTGG - Intronic
1100029588 12:90169831-90169853 ATCCAATTCTCCTGAAGGACAGG + Intergenic
1103936246 12:124478606-124478628 TTCCAAATCTCTTCACGGCCTGG + Intronic
1105034338 12:132908046-132908068 TTCTAAATTTCCACAGGGGCTGG - Intronic
1106138090 13:26989667-26989689 TGCCAAATGTCTTGAGGGGAGGG - Intergenic
1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG + Intronic
1107999283 13:45891586-45891608 ATCTAAATCTTCTGTGGGGCAGG + Intergenic
1108571740 13:51758434-51758456 TCCTAAATCTCCTGAGTAGCTGG - Intronic
1110170432 13:72493776-72493798 TTCATAATTTCCAGAGGGGCTGG - Intergenic
1112696570 13:101955618-101955640 ATGCAAGTCTCCTGAGGGGAAGG + Intronic
1113074594 13:106455320-106455342 ATCCAGATCCCCTGTGGGGCAGG + Intergenic
1113469382 13:110533715-110533737 TTCTAATGCTCCTGAGGGGATGG - Intronic
1113596656 13:111538547-111538569 TTCCCAGTCTCCCAAGGGGCTGG - Intergenic
1114840120 14:26253293-26253315 ATCCAAATCTTTTCAGGGGCTGG + Intergenic
1115532173 14:34337549-34337571 TTCCAAATCTCCTGAGGGGCTGG - Intronic
1118603909 14:67489153-67489175 TTCTCAGGCTCCTGAGGGGCAGG + Intronic
1121885981 14:97543004-97543026 TTCCAAATCACATGGGGGGAAGG + Intergenic
1122775250 14:104114075-104114097 TCCCTCAGCTCCTGAGGGGCTGG + Exonic
1123969604 15:25494637-25494659 TTCCATATCTCCTGAGCTCCTGG - Intergenic
1124690211 15:31815568-31815590 TGCCAAAGCCCGTGAGGGGCTGG + Intronic
1127772504 15:62243050-62243072 GCCCCAATCTCCTGGGGGGCTGG + Intergenic
1128644700 15:69367827-69367849 TTCCAGAGCTCCTGAGTGACTGG - Intronic
1130192560 15:81750560-81750582 TCCCAAAGCTCATGATGGGCTGG + Intergenic
1130398173 15:83523324-83523346 TCCAAACTCTTCTGAGGGGCAGG - Intronic
1137402645 16:48165703-48165725 TTCCAAATTCCCTGAGGGCAGGG + Intergenic
1137986083 16:53109241-53109263 TGACACGTCTCCTGAGGGGCAGG + Intronic
1141106861 16:81241197-81241219 TGCCCAGTCTCCTGAGGAGCTGG - Intronic
1141695109 16:85615395-85615417 TTCCTGATCTCCTGCGGGCCGGG + Intronic
1143282796 17:5767165-5767187 TTTCGACTCTCCAGAGGGGCAGG + Intergenic
1143764593 17:9129241-9129263 TTCCAAGGCTCCTGAGTGGCTGG + Intronic
1144137246 17:12308438-12308460 TTCTCAATCTCCTGAGTAGCTGG + Intergenic
1145066681 17:19766251-19766273 GTCCGAGTCTCCTTAGGGGCAGG + Intergenic
1146146833 17:30426315-30426337 CTCCAATTCTCCTGCGTGGCTGG - Intronic
1151827388 17:76530891-76530913 TCCCATATCTCCTGAGGCCCTGG - Intronic
1151853054 17:76702552-76702574 TTTAAAATCTCTTGAGGGCCGGG + Intronic
1152145854 17:78568333-78568355 TTCTACACCTCCTGGGGGGCAGG - Intronic
1152512276 17:80798483-80798505 TCCCAAACCCCCTGAGGGACTGG - Intronic
1153675513 18:7453028-7453050 ATCCAGATCTCCTGCAGGGCTGG - Intergenic
1155516279 18:26626586-26626608 TACCTCAGCTCCTGAGGGGCTGG + Intronic
1156313321 18:35944931-35944953 TTTTATAACTCCTGAGGGGCAGG - Intergenic
1156957756 18:42989254-42989276 ATACAAATCTCCTGAGGATCTGG + Intronic
1157520112 18:48339634-48339656 TTCCAAGTCACCTCAGGGGTGGG + Intronic
1157829411 18:50843039-50843061 TTCAAAATCTGCTGACAGGCTGG + Intergenic
1158328565 18:56336796-56336818 TGCCAAATGTCCAGAGGGCCAGG + Intergenic
1159005124 18:63004391-63004413 TTCCAAATCTCCCAAGTGTCTGG - Intergenic
1159543968 18:69816251-69816273 TTCCAAATCTCCTGATCTACTGG + Intronic
1160120011 18:76121904-76121926 TTCCATATCTCCTGGTGGTCAGG - Intergenic
1161699368 19:5786607-5786629 AGCCAAAACTCCTGAAGGGCTGG - Intronic
1165717839 19:38058105-38058127 TTCCTGGTCTCCTGAGGGCCTGG + Intronic
1168512426 19:56983579-56983601 TGCCAAATCTCCTAAGAGCCAGG + Intergenic
925465937 2:4107385-4107407 TCCCACATCTCCCCAGGGGCTGG - Intergenic
926190032 2:10721558-10721580 ATGCAAATATCCTGCGGGGCCGG + Intergenic
926782457 2:16486218-16486240 CTCTAATTCTTCTGAGGGGCTGG - Intergenic
927327107 2:21817780-21817802 GTCAAAATCTCCTGGAGGGCTGG - Intergenic
928614509 2:33023711-33023733 TTCAAAATCTCCTTAAGAGCAGG - Intronic
933486731 2:82933812-82933834 TTCTAAATCTCCCGAGTAGCTGG + Intergenic
934589801 2:95536923-95536945 TGCCCAGTCTCCTGAGTGGCTGG - Intergenic
935157287 2:100494552-100494574 TTCCAACTCTCCAAAGGGGTTGG - Intergenic
935592096 2:104853605-104853627 TTACAAATCTCTGGCGGGGCGGG + Intergenic
936062003 2:109300994-109301016 TTCCTCATCTGCAGAGGGGCAGG + Intronic
937709359 2:124961356-124961378 TGCTCAATCCCCTGAGGGGCGGG - Intergenic
938091660 2:128438542-128438564 TGCCAAATCTCCTCAGAGTCTGG + Intergenic
938199513 2:129361728-129361750 TTCCAAATGTCCCTAGGGCCAGG + Intergenic
938665290 2:133528728-133528750 TTCCAAATGTCCTGAGTGAAGGG - Intronic
940593382 2:155758842-155758864 TTCCACGCCTCCTGAGTGGCTGG - Intergenic
941619696 2:167762735-167762757 CACCAAATTTCCTGAGAGGCTGG + Intergenic
945221337 2:207487511-207487533 TTGCAAATCTCCTCAGTGTCTGG - Intergenic
946284605 2:218693620-218693642 TACCAGATCTTTTGAGGGGCTGG + Intronic
947995148 2:234521273-234521295 ATCAGAATCTCCTGAGGTGCTGG - Intergenic
1168829304 20:835860-835882 TTCCCAATCTCCTCTGGGGCAGG + Intronic
1168965393 20:1895240-1895262 CTCCATTTCTCCTGGGGGGCGGG + Intronic
1169777007 20:9265931-9265953 ATCGAAATCTCTTGAAGGGCTGG - Intronic
1170450746 20:16481048-16481070 TTCCAACTCTTCTGAGGCTCAGG + Intronic
1174506654 20:51021872-51021894 TTTCAAAGCTCCTTAGGGGCGGG - Intronic
1175314459 20:58037896-58037918 TTCCAACTCACTTCAGGGGCTGG - Intergenic
1180557639 22:16590950-16590972 TTCCAGATCTCCTGATGTGTGGG + Exonic
1180658684 22:17446600-17446622 TTCCTAACCTCCTGAGTAGCTGG - Intronic
1181113504 22:20616329-20616351 CTCCAGATCTCCTGGGAGGCGGG + Intergenic
1182816523 22:33169553-33169575 ATAAAAATGTCCTGAGGGGCTGG + Intronic
1183288714 22:36984495-36984517 TTCCAAGTCTCCAGAGGGAAGGG - Intergenic
1183394739 22:37565072-37565094 ATACAATACTCCTGAGGGGCTGG - Intronic
949597550 3:5564028-5564050 GTGAAAATCACCTGAGGGGCCGG + Intergenic
949852157 3:8430220-8430242 TTCCTAAGGTCCTGAGTGGCAGG - Intergenic
950449631 3:13058439-13058461 TTCCAAACATCCTTGGGGGCAGG + Intronic
950449991 3:13060102-13060124 TTCCAAACATCCTTGGGGGCAGG + Intronic
953039332 3:39241007-39241029 TTCAAAATCTGCAGAGAGGCTGG - Intergenic
954012052 3:47649830-47649852 TTCCAACTCTCTTGAGGGAAAGG + Intronic
956058039 3:65321446-65321468 CTCCACAGCTGCTGAGGGGCAGG + Intergenic
956760500 3:72439252-72439274 TTCCACATCTCCTCAGGAGCTGG - Intronic
963266280 3:143243183-143243205 TTCCCTGTCTCCTTAGGGGCAGG + Intergenic
963942169 3:151106078-151106100 TTCCAACTCTCATGAGAGCCTGG + Intronic
964915007 3:161829971-161829993 TGTCAAATGTCCTCAGGGGCTGG - Intergenic
966634584 3:182118215-182118237 TTTCCAAACTCCTGAGGTGCAGG + Intergenic
968044496 3:195616481-195616503 TTCCAGAGCTACTGAGGGGCTGG + Intergenic
968060285 3:195722532-195722554 TTCCAGAGCTACTGAGGGGCTGG + Intronic
968147824 3:196314277-196314299 TTGCAGATCTCTTGAGGGTCAGG + Intronic
968686966 4:1967281-1967303 TTAAAAATCTCCTGAGAGGCCGG + Intronic
968798687 4:2727321-2727343 TTCCAAATCTCTTGAGGGCCAGG - Intronic
971380953 4:26097195-26097217 TTCCAGAGCCCCTGAGGGCCTGG - Intergenic
971417029 4:26441135-26441157 TTCCAAATCTCATTAGTGACGGG - Intergenic
971474285 4:27057721-27057743 TGCCAAATCTTTTGAGGGCCGGG - Intergenic
973760219 4:54108666-54108688 TTCCTAATTGACTGAGGGGCAGG + Intronic
974113022 4:57547445-57547467 AACCACAGCTCCTGAGGGGCAGG + Intergenic
974277737 4:59747879-59747901 TCCTAAATCACCTGCGGGGCTGG + Intergenic
975555760 4:75663380-75663402 CGCTAAATCTCCTGAGTGGCTGG + Intronic
977771817 4:100869385-100869407 TTCACTATCTCCTGTGGGGCTGG + Intronic
978084225 4:104631013-104631035 TTCAAAAAATCCTGAGGGGGAGG + Intergenic
981405938 4:144369241-144369263 TTCCAACTTTCCTGATGGTCAGG + Intergenic
990730279 5:58801048-58801070 TTCCAAGTCTCTTTTGGGGCGGG - Intronic
994165305 5:96602005-96602027 TTCAAACTCTCTTGAGTGGCAGG + Intronic
994392017 5:99200819-99200841 TTCCCAATATCCAGAGGGGGAGG - Intergenic
997007144 5:129831412-129831434 TGCCAAATGTCCTGAGGAGTGGG + Intergenic
999378716 5:151105030-151105052 TGCCAAATATCCTCCGGGGCGGG + Intronic
999393082 5:151208510-151208532 CCCCAAATCTGCTGAGTGGCTGG + Intronic
1001286253 5:170426071-170426093 TTCCAAATCACTGGAAGGGCTGG - Intronic
1003973491 6:11321590-11321612 CTCCAGATCTCCTGAGGTTCAGG - Intronic
1004996228 6:21195804-21195826 TTAAAAATCTCCAGAGTGGCCGG - Intronic
1005286799 6:24336242-24336264 TTCAAAATCTCTGGTGGGGCTGG - Intronic
1005306747 6:24521365-24521387 TGTCAAATCTGCTGAGGAGCTGG + Intronic
1005462582 6:26083226-26083248 TTCCCAACCTCCTGAGTGGCTGG + Intergenic
1005690098 6:28296697-28296719 TACAAAATGCCCTGAGGGGCTGG + Intronic
1006505799 6:34487893-34487915 TTCCAAGTAGCATGAGGGGCAGG - Intronic
1006948070 6:37798681-37798703 TTCCATCTGTCCTGAGAGGCTGG + Intergenic
1009228044 6:61035458-61035480 TTCCTAATATCCAGAGGGGGTGG - Intergenic
1013251117 6:108334393-108334415 TTACAAATAGACTGAGGGGCCGG + Intronic
1013829339 6:114254215-114254237 TGCCAAATCTCAGGTGGGGCAGG - Intronic
1016274757 6:142335958-142335980 TTCCAAACCTCTTGAAGGGATGG - Intronic
1016868262 6:148790816-148790838 TTCCAGAGCTCCTGTGGGACAGG + Intronic
1017960011 6:159213371-159213393 TTTGAAATTTCCTGAGGGTCGGG - Intronic
1018784502 6:167097784-167097806 TTTAAAATCTCCTGAGAGGCCGG - Intergenic
1018880260 6:167871117-167871139 TTCCCAATCTGTTGGGGGGCGGG - Intronic
1019968950 7:4524710-4524732 TTCTCAACCTCCTGAGAGGCTGG - Intergenic
1020388943 7:7638444-7638466 ATCGAAAACTCTTGAGGGGCTGG + Intronic
1022101637 7:27172844-27172866 TTTCAAAGTTGCTGAGGGGCGGG - Intronic
1024996722 7:55278172-55278194 TCCCATCTCTCCTGAAGGGCTGG - Intergenic
1026937411 7:74265948-74265970 TTCTAAATCTGATGAGGGGTGGG + Intergenic
1036086054 8:5614407-5614429 TTCCAGAGCTCCAGATGGGCAGG + Intergenic
1036514803 8:9433972-9433994 TTCCAGCTCTCCTGAGAGGGAGG + Intergenic
1036699705 8:11004175-11004197 TTAAAAAGCTCCTGTGGGGCCGG + Intronic
1040811380 8:51457649-51457671 TTCCAAATCCAATGAGTGGCTGG + Exonic
1043023424 8:75035728-75035750 TTGCAAATATCATTAGGGGCTGG + Intergenic
1043424531 8:80135427-80135449 CTCTAACTCTCCTGGGGGGCAGG - Intronic
1044272487 8:90263803-90263825 TTCCAAATACCCTGAGTAGCAGG - Intergenic
1045179803 8:99768197-99768219 TGCCACTTCTCCTGATGGGCTGG + Intronic
1046360586 8:113149069-113149091 ATCAAAATCTTCTGAGGAGCAGG + Intronic
1047938426 8:129804300-129804322 TTACACATCTCCTCAGGTGCTGG - Intergenic
1048501844 8:134984653-134984675 TTAAAAATCTCCTGTGGTGCGGG - Intergenic
1049937854 9:516850-516872 TTCCTAATCACCTGAAGGACAGG - Intronic
1050985076 9:12071944-12071966 TTCCCAGTCTCCCGAGGAGCTGG + Intergenic
1056817552 9:89812521-89812543 TTCCAAATCTTGTAAGAGGCTGG + Intergenic
1058890505 9:109356710-109356732 TTGCAAGTCTCCTGAGTAGCTGG - Intergenic
1059100600 9:111468322-111468344 TTCCAAAACTACTAAGTGGCAGG + Intronic
1059496464 9:114713754-114713776 TGCCAAACATCCTGAGGGGTGGG - Intergenic
1060813014 9:126620487-126620509 TTCCACCTCTCTTGAGGTGCAGG - Intronic
1062611139 9:137374022-137374044 TCCCAAATCTCCTGCGGGTCAGG - Intronic
1187101037 X:16192098-16192120 TTCCAAATGTCCTTCGGTGCTGG + Intergenic