ID: 1115532777

View in Genome Browser
Species Human (GRCh38)
Location 14:34342447-34342469
Sequence GATCCAGGAGTGGCCTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115532777_1115532781 13 Left 1115532777 14:34342447-34342469 CCTTTCTAGGCCACTCCTGGATC 0: 1
1: 0
2: 6
3: 25
4: 165
Right 1115532781 14:34342483-34342505 ATGAGAATCTGACACATTTAAGG 0: 1
1: 1
2: 4
3: 28
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115532777 Original CRISPR GATCCAGGAGTGGCCTAGAA AGG (reversed) Intronic
903473917 1:23606529-23606551 CCTCCATGAGTGGCCTAGAGTGG + Intronic
903758992 1:25684705-25684727 GCACCAGGAGTGGCCGAGCATGG + Intronic
905238649 1:36567923-36567945 GATCCAGATGGGGCTTAGAATGG - Intergenic
905991274 1:42338848-42338870 GAGACGGGAGTGGACTAGAAGGG + Intergenic
906643747 1:47458113-47458135 GATCCAGGAGGGTCCCAGAGGGG + Intergenic
908568888 1:65387967-65387989 TAGCCAGCAGTGGCCTAGAAAGG + Intronic
913091469 1:115479223-115479245 GCTCCAGGAGCGGCCTGGCAGGG + Intergenic
916449796 1:164909508-164909530 GATCCAGGAATTGCCTAGAAAGG + Intergenic
916450428 1:164915442-164915464 CATCCAGGGGTGGCTTAGATAGG - Intergenic
916863222 1:168828897-168828919 GAACCAAGAGTGGCCTATACTGG + Intergenic
918551607 1:185748843-185748865 GACCCAAGAGTGTCCTATAAGGG + Intronic
920114276 1:203609009-203609031 TAGCCTGGAGTGTCCTAGAATGG - Intergenic
922058622 1:222065814-222065836 GATCTAAGAGTGGCTTAGCAAGG + Intergenic
922070856 1:222191878-222191900 GATCAAGGAGAGGCCTAGAGTGG - Intergenic
922128612 1:222754655-222754677 AATCCAGGAGTGGCTTAGCTGGG - Intergenic
1065609741 10:27461208-27461230 GATCCAGGAAAGGCCTGCAAAGG + Intergenic
1065810931 10:29443061-29443083 GATCCAGGAAAGGCTTGGAAAGG + Intergenic
1067050313 10:43012606-43012628 GATCTAGGAAAGGCCTAGAAAGG - Intergenic
1069222957 10:65906561-65906583 GATCCAGGACTGGCCTTTATTGG - Intergenic
1070637479 10:78140726-78140748 GAGCCTGGAGTGAGCTAGAAAGG - Intergenic
1070650394 10:78231287-78231309 GAACCAGAAGTGTCCCAGAAAGG + Intergenic
1070927751 10:80236720-80236742 CCTCCAGGAGTGGCTGAGAAGGG - Intergenic
1072546920 10:96447164-96447186 GATCCAGAAGGAGCCTAGACGGG + Intronic
1073206073 10:101770050-101770072 GCTCCATTAGTGGCCTAGACTGG - Intergenic
1075515776 10:123106824-123106846 GCTCCAGGACTGTCCTGGAAAGG + Intergenic
1076212445 10:128659281-128659303 GCTCCAGCACTGGCCTAGGAAGG + Intergenic
1076471187 10:130719433-130719455 ATCCCAGGAGTGGCCTCGAAGGG + Intergenic
1077153817 11:1082791-1082813 GACCCGGCAGTGGCTTAGAAAGG - Intergenic
1079724818 11:23867710-23867732 GATCCAGGAAAGTCCTAGAAAGG + Intergenic
1080895941 11:36448934-36448956 GAGGCAGTAGTTGCCTAGAAAGG - Intronic
1080962632 11:37178355-37178377 GATCCAGGAAAGGCCTAGAAAGG - Intergenic
1081818834 11:45971025-45971047 AATCCAGCAGGAGCCTAGAAGGG + Intronic
1083049191 11:59761899-59761921 GAACCAGGAGAGGACTAGACAGG - Intronic
1085526321 11:77166292-77166314 GCTCCAGGAGGGGCCTGGAGGGG + Intronic
1088330210 11:108643398-108643420 GATCCTTGAGTAGCCTAGAGGGG + Intergenic
1090246140 11:125217223-125217245 GATCCAGGAGTGGGAAAGGAGGG - Intronic
1092878447 12:12868675-12868697 TATCCAGTAATGGCCTTGAAGGG + Intergenic
1092941182 12:13408644-13408666 GACCCAGAAGTGGCTTAAAATGG - Intergenic
1098315253 12:69185830-69185852 GGTCCTGGAAAGGCCTAGAAAGG + Intergenic
1099620393 12:84996274-84996296 GATCAAAGAGAGGCCTAGTAAGG - Intergenic
1102947959 12:117006473-117006495 CATCCAGGTGTGGCCTGGACTGG - Intronic
1104108772 12:125687193-125687215 TACCCAGGCGTGGCCTTGAAAGG + Intergenic
1104313991 12:127680082-127680104 GATCCAGGAAAGGCCTGGAAAGG - Intergenic
1104592030 12:130092452-130092474 GAGCCAGGGGTGGCCCAGCAGGG + Intergenic
1106342930 13:28848330-28848352 GAACCATGAGTGGCTTAGGAAGG - Intronic
1106511776 13:30419338-30419360 GATCCAGCAGAGGCCAGGAAAGG + Intergenic
1108100344 13:46947650-46947672 GATCTAGGAAAGGCCTAGAAAGG + Intergenic
1109669206 13:65583039-65583061 GATCCTGGAAAGGCCTAGATAGG - Intergenic
1115532777 14:34342447-34342469 GATCCAGGAGTGGCCTAGAAAGG - Intronic
1115888007 14:37995122-37995144 GATCCTGGGAAGGCCTAGAAAGG - Intronic
1115938634 14:38583818-38583840 GATCCAGGAAAGGCCTAGAAAGG - Intergenic
1116093731 14:40340793-40340815 GATGCAGGAAAGGTCTAGAAAGG - Intergenic
1116721604 14:48503571-48503593 GATCCAGATCTGGCCTACAATGG + Intergenic
1121856527 14:97275485-97275507 GAACAAGGAGTGTCCTAGACTGG - Intergenic
1122300917 14:100730610-100730632 GATCCAGGATTGGCATAGCAGGG + Intronic
1122862827 14:104590166-104590188 TTTCCAGAAGTGGCCCAGAAGGG + Intronic
1123986828 15:25653698-25653720 GATCAGGGAAAGGCCTAGAAAGG + Intergenic
1124096356 15:26651958-26651980 GATCTGGGAAAGGCCTAGAAAGG - Intronic
1125748390 15:42012633-42012655 GAGCTGGGAGTGGCCAAGAAAGG - Intronic
1126550344 15:49921844-49921866 GATCCAGTTGTGGTCTTGAAAGG - Intronic
1128325147 15:66719391-66719413 TGTCCAGTAGTGGCCTGGAAGGG - Intronic
1129602832 15:77010149-77010171 GATCCAGCAGTGGGCGAGGAAGG - Intronic
1130023480 15:80251060-80251082 GATGCACGAGTGGGTTAGAATGG + Intergenic
1137536975 16:49334642-49334664 AATCCAGGATTGGCCTCCAAGGG - Intergenic
1138436619 16:57004208-57004230 GGTGCAGGAGAGGCCTAGGAGGG + Intronic
1140260518 16:73374385-73374407 GAACCAGGACTGGCCTTGAATGG - Intergenic
1146021839 17:29286047-29286069 GATACCAGAGAGGCCTAGAAAGG - Exonic
1148088024 17:45006451-45006473 GATCCAGGAGGGCCTTTGAAAGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148756564 17:49976152-49976174 GATCCAGGAGTGGTGAGGAATGG + Intergenic
1149154439 17:53609654-53609676 GATCCTGGAAAGGCCTGGAAAGG - Intergenic
1154123746 18:11672008-11672030 GATTGAGGAAAGGCCTAGAAAGG + Intergenic
1157173162 18:45426867-45426889 GGTCCAGAATTGGCCGAGAAGGG - Intronic
1157472259 18:47998992-47999014 GATCCTGGAGAGGCCTGGCAGGG - Intergenic
1158676087 18:59519240-59519262 ACTCCAGGAGTGGGCTAAAAAGG - Intronic
1159206123 18:65255242-65255264 GATCCAGGAAAGGCCTGGAATGG - Intergenic
1164328862 19:24231944-24231966 GATCCCTGAGTGGCCTAACAAGG + Intergenic
1165365162 19:35360745-35360767 GATGAAGGAGTGGCCCAGAGAGG + Intergenic
1165366980 19:35373213-35373235 GATGAAGGAGTGGCCCAGAGAGG + Intergenic
1166345558 19:42163189-42163211 GAACCAGGAATGGCCCACAAAGG + Intronic
1166731637 19:45062281-45062303 GATCTTGGGGTGGCCTAGCAGGG - Intronic
1167061263 19:47148264-47148286 GATACAGGGTTAGCCTAGAATGG + Intronic
1167493056 19:49802778-49802800 CATCCAGCAGTGGCCTCCAATGG - Intronic
925293896 2:2765519-2765541 GATACAGGAGGGGCCTATAGAGG + Intergenic
926484467 2:13437780-13437802 GAGCCAGGAGTGGACTAATATGG - Intergenic
926856024 2:17256882-17256904 CATTCAGGAGTGGGCAAGAAGGG + Intergenic
927296493 2:21460473-21460495 GTTCCAGGAGTGTACTAGGAAGG - Intergenic
927656113 2:24948136-24948158 GAACCAACAGTGGCCTGGAATGG + Intronic
927767682 2:25827840-25827862 GATCTAGGAATCGCCTAGAGAGG + Intronic
927811096 2:26180527-26180549 GATCCTGGAGAGGCCAAGAAAGG - Intronic
927950626 2:27166161-27166183 GATCTTGGAAAGGCCTAGAAAGG - Intergenic
929697871 2:44134661-44134683 GATCTGGGAAAGGCCTAGAAAGG + Intergenic
929924647 2:46198112-46198134 AAGCCAGGAGTGATCTAGAATGG + Intergenic
930058868 2:47272408-47272430 GGTTGAGGAGTGGCCTAGGAAGG + Intergenic
931415106 2:62073256-62073278 GATGCAGGAAAGGCCTAGAAAGG - Intronic
932284094 2:70518209-70518231 CCAGCAGGAGTGGCCTAGAAGGG - Intronic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
934231998 2:90192343-90192365 GATCAAGGAAGGGCTTAGAAGGG - Intergenic
935816349 2:106849608-106849630 GGTCCAGGAAAGGCCTAGAAGGG - Intronic
936647833 2:114392239-114392261 GAGCCAGAAAAGGCCTAGAAAGG - Intergenic
936936185 2:117840235-117840257 GATGCTGGAGTGGCCTGGGAAGG + Intergenic
938056979 2:128223188-128223210 GATCCAGGAAAGGGCTAGAAAGG + Intergenic
938389875 2:130896737-130896759 GGACCAGGGCTGGCCTAGAAGGG + Intronic
939067671 2:137504140-137504162 GAACCAGAAGTGGCCTTTAAAGG - Intronic
942339216 2:174925491-174925513 GGTCCAGGAAAGACCTAGAAAGG - Intronic
942525018 2:176843754-176843776 AATCCAGAAGTAGGCTAGAATGG - Intergenic
944939645 2:204609792-204609814 GATGCAGGAAAGACCTAGAAAGG + Intronic
946612754 2:221477167-221477189 GATTCATGAGGGGCCTTGAAAGG + Intronic
947934725 2:233994248-233994270 GAACCAGCTGTGGACTAGAAAGG + Intronic
948878658 2:240844015-240844037 GATCCGGGAAAGGACTAGAAAGG - Intergenic
949076669 2:242063643-242063665 GATCCAGGAAAGGCCTAGAAAGG + Intergenic
1169116388 20:3069055-3069077 GACCCAGCAGTGGCCCAGAGAGG - Intergenic
1172852672 20:37977887-37977909 GATCAAGAAGTGGCCTTGGAAGG - Intergenic
1174262947 20:49310561-49310583 GATCCAGGTGTGGCTTAGTTAGG + Intergenic
1179448869 21:41454031-41454053 GATTCAGGGAAGGCCTAGAAGGG + Intronic
1179607543 21:42527091-42527113 GTTTCAGGATTGACCTAGAAAGG + Intronic
1181045671 22:20213162-20213184 GATCCAGGATTGGCAAAGCAGGG - Intergenic
1183966184 22:41444371-41444393 GAACATGGAGTGCCCTAGAAAGG - Intronic
1185253338 22:49817166-49817188 GCTCCAGGAATGGCTCAGAAGGG + Intronic
951804043 3:26625323-26625345 GCTCCAGGGGTGCCCCAGAATGG - Intronic
951906878 3:27715021-27715043 GGTCCAGGAGGGGGCTGGAAAGG + Intergenic
952197848 3:31094868-31094890 TATCCAGGAGTGGCATGGGATGG + Intergenic
953021643 3:39118237-39118259 GATCCAGGAGCTCCCTACAAGGG - Intronic
957686886 3:83513932-83513954 GATCCAGAAAAAGCCTAGAAAGG + Intergenic
959343137 3:105157046-105157068 GATCCAAGAAAGGCCTAGAAAGG - Intergenic
962871870 3:139503692-139503714 GATCCATGAGTGGCCTGTATAGG + Intergenic
964514889 3:157497252-157497274 GATCCAGGAGCAGTGTAGAAGGG - Intronic
971402416 4:26288212-26288234 AATCCAGGAGTGGCTTAGCTGGG + Intronic
975273407 4:72465588-72465610 GATCCAGGATTGAACTAAAAAGG + Intronic
976839948 4:89420340-89420362 AATCCAGGAGTGGAAAAGAAGGG + Intergenic
978597510 4:110394107-110394129 GATCCAGGAAAGACCTAGAAAGG - Intronic
978894549 4:113871358-113871380 GATCCAGGAAAGGCCTAGAAAGG + Intergenic
979672815 4:123378936-123378958 CCTCCAGGAAAGGCCTAGAAAGG - Intergenic
984050158 4:174855825-174855847 GATCCAGGACAGGGATAGAAAGG - Intronic
984240842 4:177217830-177217852 GAACTAGCAGTTGCCTAGAATGG + Intergenic
988445929 5:31286195-31286217 GATACAGAAGTGACCTAGACAGG + Intronic
988860591 5:35273857-35273879 GATAGAGGAGTGGCCCAGGAAGG - Intergenic
990296174 5:54403731-54403753 AATCCAGGAGTGGCTTAGTTGGG - Intergenic
990407753 5:55508556-55508578 GATCTGGGAGTGGCTCAGAAAGG + Intronic
990605295 5:57403652-57403674 AATCCTGAAGTGGCCTAGCAGGG + Intergenic
998674685 5:144394203-144394225 GATCCATGAGTGGCAGAAAATGG - Intronic
999128524 5:149264891-149264913 GTTCCAGCAGTGGCCCAGAGAGG - Intergenic
999327205 5:150650672-150650694 GCTGGGGGAGTGGCCTAGAAGGG + Exonic
1002592577 5:180301016-180301038 GATTCAGGAGCAGCCTAGAGAGG + Exonic
1002598357 5:180338974-180338996 CATCTAGGAGTGCCATAGAAAGG + Intronic
1002851953 6:1004099-1004121 GACCCAGGAGGGGCCTGGCAGGG - Intergenic
1005192930 6:23246830-23246852 GATCAAGGAGTGGCGCAAAAAGG - Intergenic
1005651495 6:27889333-27889355 GATCCAGGAAAGGACTAGAAAGG - Intergenic
1006074930 6:31526125-31526147 GAGGCAGGAGTGGCTCAGAAGGG - Intergenic
1006092365 6:31635573-31635595 GATACAGGAATGGCCTGGGAAGG - Exonic
1006790644 6:36698932-36698954 GGACCAGGCCTGGCCTAGAAGGG + Intronic
1012779088 6:103534375-103534397 GATCCAGGACAAGCCTTGAAAGG + Intergenic
1013599872 6:111693797-111693819 GACCCAGAAGTGGGCTAGAGTGG + Intronic
1015541238 6:134316314-134316336 GTTTCAGGAGTGGCACAGAAAGG + Intronic
1015708716 6:136116202-136116224 GATTAAGGAGTTGCCTATAAGGG + Intronic
1016753243 6:147654546-147654568 GCAACAGTAGTGGCCTAGAAAGG - Intronic
1019120646 6:169801241-169801263 GGTCCTGGTGTGGCCCAGAAAGG + Intergenic
1019631229 7:2050852-2050874 TCTCCAGGAGGGGCCTAGAGAGG + Intronic
1023112385 7:36826778-36826800 GATCCAGGACTGGCCAAGCAAGG - Intergenic
1025566444 7:62440590-62440612 GATCATCGAGTGGCCTCGAATGG - Intergenic
1026068222 7:67094786-67094808 GATCCAGGAGTGGCCAACCTGGG + Intronic
1026183204 7:68060496-68060518 GATCCAGGAGTGAGGAAGAAGGG - Intergenic
1026213382 7:68326621-68326643 GATCCAAGAGAAGCATAGAAAGG - Intergenic
1026563007 7:71466003-71466025 GATCTAGGAAAGGTCTAGAAAGG + Intronic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1027640846 7:80731983-80732005 GCTCTAGGAGGAGCCTAGAATGG - Intergenic
1031131669 7:117840194-117840216 GTTCCAGAAATAGCCTAGAAGGG + Intronic
1033518409 7:142133822-142133844 GAACCAGAGGTGCCCTAGAAAGG + Intronic
1034760407 7:153667184-153667206 GTACCAGGAGTGGCCTAGGAAGG + Intergenic
1036748298 8:11425943-11425965 GATCTTGGAAAGGCCTAGAAAGG - Intronic
1037141449 8:15525179-15525201 GATCAAGAAGTGGCCAAGAAAGG - Intronic
1037367689 8:18140409-18140431 GATCATGGAATGACCTAGAAAGG - Intergenic
1038833333 8:31088265-31088287 GATTCCTGAGTGGCCAAGAAAGG - Intronic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1040417708 8:47209836-47209858 GATCCATGAAAGGCCTAGAAAGG - Intergenic
1040633547 8:49244693-49244715 GATCCAGGAAAAGCCTAGAAAGG + Intergenic
1041267770 8:56081807-56081829 GATCCAGGCATGGCTTAGGAGGG - Intergenic
1042571210 8:70167060-70167082 AATCCAGGACTGGACTTGAAGGG - Intronic
1042884441 8:73532361-73532383 GACCCAGGAAAGGCCTAAAAAGG - Intronic
1045252699 8:100494929-100494951 GAGCCAGGACTCGCCTACAAGGG - Intergenic
1050814393 9:9790790-9790812 GTTTCAGTAGTTGCCTAGAATGG + Intronic
1052745842 9:32440415-32440437 GATGCAGGAGAGGCAAAGAATGG - Intronic
1055314400 9:75019460-75019482 GATCCAGGAAAGGCCTAGAAAGG - Intronic
1062371816 9:136243270-136243292 GATCCAGGAAAGACCTAGAAAGG - Intronic
1062510067 9:136900295-136900317 GCTCCTGGAGTGGCCTGGAAAGG + Intronic
1186057544 X:5665986-5666008 GATACAGGAAAGACCTAGAAAGG - Intergenic
1186099017 X:6135182-6135204 GACCCAGGAGTGTCCCAGGAGGG + Intronic
1189685014 X:43555002-43555024 GATCCAGGAAAAGCCTAGAAAGG - Intergenic
1189848546 X:45157840-45157862 GATCCAGGAGTCGCTGCGAAGGG + Exonic
1190507248 X:51138333-51138355 CATTCAGGAGTGGCCAAAAAAGG + Intergenic
1192178630 X:68901632-68901654 GACTCAGGAGGGGCCTAGCATGG + Intergenic
1194822224 X:98523650-98523672 GATCCAGGAAATGCTTAGAAAGG - Intergenic
1196006066 X:110838562-110838584 GATCGGGGAAAGGCCTAGAAAGG - Intergenic
1196156683 X:112438123-112438145 GATTCAGGAGTGGCTTAGCTGGG + Intergenic
1196167955 X:112555794-112555816 GGTCCAGGTCTGGCCTAGTAAGG - Intergenic
1197852841 X:130882207-130882229 GACCCAGAAGTGGTCTAGAGTGG + Intronic
1198502098 X:137260392-137260414 GATCCAGGAGTGGCTTAGGTAGG + Intergenic