ID: 1115534682

View in Genome Browser
Species Human (GRCh38)
Location 14:34362097-34362119
Sequence GTGCAGCAATGGAAGGCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115534682 Original CRISPR GTGCAGCAATGGAAGGCTTA TGG (reversed) Intronic
900223879 1:1523782-1523804 GTGCACCCATGGAAGCCTCAGGG - Intronic
904038357 1:27570700-27570722 GTGCACCACTGGAAGGTTTTAGG + Intronic
904928223 1:34065130-34065152 GGGGAGCAAAGGAAGGCCTAGGG - Intronic
905320741 1:37115310-37115332 GAGGAGAAATGGAAGGATTATGG - Intergenic
910913783 1:92266880-92266902 TTTCTGGAATGGAAGGCTTAGGG - Intronic
914730865 1:150369201-150369223 GTGCAGCAGTTGGAGGCATATGG + Intronic
914797468 1:150932810-150932832 ATGCAGCAAAGCAATGCTTACGG - Intronic
920139780 1:203800723-203800745 GTGCAGCATTGAAAGGCCTTAGG + Exonic
1064650136 10:17500616-17500638 ATGCAGCAATGCAAGGCATAAGG - Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1068120531 10:52779134-52779156 GAGCAGCAAAGGAAGGCAGAGGG + Intergenic
1069002911 10:63285518-63285540 GGGCAGTAAAGAAAGGCTTATGG - Intronic
1072039587 10:91594332-91594354 TTGCACCAATGGAGAGCTTAGGG + Intergenic
1075123612 10:119682199-119682221 GTGCAGGAATGGATGGCTGTAGG - Intergenic
1075312416 10:121425679-121425701 GTTCAGAAATGGAAGGTTTGTGG - Intergenic
1077059622 11:612289-612311 GTGCAGCAGTGGCAGCCTGAGGG + Intergenic
1077139025 11:1015423-1015445 GGGCAGCCAGGGAAGGCTTTTGG + Intronic
1077896096 11:6454647-6454669 GTGCAGCACAGGAAGGCATTTGG - Intronic
1078089870 11:8258377-8258399 GTGCAGCTAGGGAAGGCTGGGGG - Intronic
1081471498 11:43376475-43376497 GTGCAGCAATGGAAGTTTGTAGG + Intronic
1082029380 11:47593775-47593797 GTGCAGCGATGTCAGGCTGAGGG + Intronic
1082883649 11:58062209-58062231 GTGCCACAATGCTAGGCTTATGG - Intronic
1091034347 11:132219733-132219755 GTGCACCAATGGAAAGCTCCTGG + Intronic
1091090697 11:132768812-132768834 GGGCAGCAATGTAAGATTTAAGG - Intronic
1091575189 12:1727515-1727537 GGGCAGCCATGGAAGACTTCTGG - Intronic
1092222466 12:6724296-6724318 GGGCAGCAATGGAGAGCTGAGGG + Intronic
1101126632 12:101642249-101642271 TTGCTGGAATGGAAGTCTTAGGG - Intronic
1109519777 13:63494436-63494458 ATACAGCAAAGGTAGGCTTAGGG - Intergenic
1110018371 13:70437715-70437737 ATGAAGAAATGGAAGGCTAAAGG - Intergenic
1110191842 13:72739437-72739459 GTGCAGAAATGTGAGGCCTATGG - Intronic
1115534682 14:34362097-34362119 GTGCAGCAATGGAAGGCTTATGG - Intronic
1116334292 14:43637938-43637960 GTGAAGAATTGGAAGGATTAGGG - Intergenic
1116873894 14:50092629-50092651 GTTCAGCCATGGAGGTCTTAGGG - Exonic
1118415361 14:65529574-65529596 TGGCAGCAATGGCAGCCTTACGG + Intronic
1119586742 14:75842861-75842883 GTCCAGGTATGGAAGGGTTAAGG - Intronic
1120397614 14:83987628-83987650 GTGCAGTAATGGTTTGCTTATGG + Intergenic
1120821465 14:88915339-88915361 GTGCAGGGGTGGAAGGGTTAGGG + Intergenic
1122689398 14:103524603-103524625 GTGCAGGAATTCCAGGCTTAAGG - Intergenic
1125283474 15:38068656-38068678 GGGCAGCCAGGGAAGGCTTGAGG - Intergenic
1126877225 15:53056640-53056662 GAGAAGCATTGGAAGGTTTAAGG + Intergenic
1127010353 15:54619378-54619400 GTGCAGCAAAGAAAGGATAAGGG - Intronic
1128450139 15:67801214-67801236 GTCCAGCAATGAAAGGCAAAGGG + Intronic
1135565145 16:23506272-23506294 GTGCTGCAATGGAGGGATAAGGG - Intronic
1135933029 16:26755540-26755562 GTGCAGAAATAGAAGGCTCGAGG - Intergenic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1144811145 17:17999614-17999636 CTGCAGCCATGTAAGGCTTGGGG + Intronic
1148256640 17:46139098-46139120 GAGCAGCAATGAAAGACTTCTGG - Intronic
1152571452 17:81123014-81123036 GTACAGGGAGGGAAGGCTTAAGG - Intronic
1155356591 18:24959512-24959534 GAGAAGCAATTTAAGGCTTAAGG + Intergenic
926039929 2:9664925-9664947 GGGGAGCCATGGAAGGCTTTTGG - Intergenic
926219596 2:10925850-10925872 GGGGAGCCATGGAAGGCTTTAGG - Intergenic
929149898 2:38738118-38738140 GTGCAGGCAGGGAGGGCTTATGG + Intronic
940762091 2:157749874-157749896 GTGCACCAATGGGAGGCCTGAGG + Intronic
941814024 2:169782746-169782768 GAGCAGCACTGGAAGGCCTTTGG - Intergenic
945516396 2:210768055-210768077 GAGCAGCATTTGAAGGCTTCTGG - Intergenic
946478223 2:220029434-220029456 GAGCAGCAATAGCAGGCTCAGGG + Intergenic
946926667 2:224633259-224633281 GTGTAGAAATGGGAGGCCTAGGG + Intergenic
947651015 2:231786379-231786401 GTGCAGCGGTGGGAGGCTTCCGG + Intronic
1169053471 20:2600045-2600067 TTACAGCAATGGGGGGCTTATGG + Intronic
1170609287 20:17899009-17899031 GTGCAGCCATGCATGGCTTGAGG - Intergenic
1172644340 20:36460829-36460851 GGGGAGGAATGGAAGGCTCAGGG + Intronic
1174416154 20:50368592-50368614 GGGGAGCCATGGAAGGCTTATGG - Intergenic
1176143957 20:63557265-63557287 CTGCAGCCAGGGAAGGCTTCTGG - Intergenic
1181344972 22:22212703-22212725 GTGGAACAATAGAAAGCTTATGG + Intergenic
1181903905 22:26178065-26178087 GTGTGGCAATGGAAGTTTTAAGG + Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
952833869 3:37588280-37588302 GTGTAGAAATGGATGGCTTGGGG + Intronic
955098932 3:55828175-55828197 GGCCAGCAATGGAAGTCTCAGGG - Intronic
955956013 3:64291135-64291157 CAGCAGCAATGCAAAGCTTAGGG + Intronic
958260105 3:91370102-91370124 GTACTGCAATGGAAAGCTCAAGG + Intergenic
961742214 3:129039999-129040021 GTGCTGCAATGGGAGGCTCTGGG - Exonic
962745429 3:138394420-138394442 GTGCAGCAATGAAGGGCTGTGGG + Intronic
965018918 3:163200039-163200061 TGGCAGCAATGCAAGTCTTATGG + Intergenic
965967897 3:174518346-174518368 GTCCAGTAATGGGAGGCTTAGGG + Intronic
968272813 3:197417675-197417697 GTGCAGTTATGTAAGGCTTGAGG + Intergenic
969210676 4:5684861-5684883 GTGCAGCCAGGGAAGGCCTTAGG + Intronic
972170714 4:36342353-36342375 GTTCAGTAATGGAAGGCAGATGG + Intronic
972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG + Intronic
975555613 4:75662016-75662038 GTGCAGCAAAGAAATGGTTATGG - Exonic
975827107 4:78331426-78331448 GCAGAGCACTGGAAGGCTTAGGG + Intronic
982713067 4:158777908-158777930 GTACAGCAATGGTAGCCTTTGGG - Intronic
986047025 5:4048738-4048760 GTGCAGCAAAGAAAGTGTTACGG - Intergenic
986549438 5:8936113-8936135 GTGCAGCAGGGGAAGGCTGTGGG - Intergenic
990676773 5:58195492-58195514 GTGAAGCAATGGAAGCTCTAGGG + Intergenic
992339229 5:75805336-75805358 CTGCTGCAATGGAGGGCCTAAGG - Intergenic
995043051 5:107610805-107610827 GTGCCGCTATGGAAGGCTCAGGG - Intronic
999600251 5:153254585-153254607 GTGCAACAATGGAAGTTTTCTGG - Intergenic
1003280292 6:4685427-4685449 GTGAAGCACTGGAAGGCTTATGG + Intergenic
1005385420 6:25280021-25280043 GTGCAGAGAGGGAAGGCTTCGGG + Intronic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1007246357 6:40466041-40466063 GTACAGCAAGGGAAGACTTGAGG + Intronic
1008995131 6:57650302-57650324 GTACTGCAATGGAAAGCTCAAGG - Intergenic
1009183667 6:60549062-60549084 GTACTGCAATGGAAAGCTCAAGG - Intergenic
1009734826 6:67663016-67663038 GTGCAGCAAGGGGAGGGGTATGG + Intergenic
1012080846 6:94756671-94756693 GTACAGAAATGGAAGACTCATGG + Intergenic
1016467973 6:144345687-144345709 GGGCAGCAATTGCAGGCTTGTGG + Intronic
1020888162 7:13845680-13845702 GTGCAGCTATAGAAGGGATAAGG + Intergenic
1020894326 7:13920605-13920627 AGGCAGTAATGGAAGGCTGAAGG - Intronic
1021605444 7:22405155-22405177 GGGGAGCAATGGAATGCTTATGG - Intergenic
1023757221 7:43431192-43431214 GTGCAGGAATAGATGGCTCATGG - Intronic
1024937857 7:54729854-54729876 GTGCATGAATGAAAGGATTATGG - Intergenic
1026731441 7:72915020-72915042 GTGAAGAAATGAGAGGCTTAGGG + Intronic
1029158566 7:98534781-98534803 GTGAAGCCATGGAAGGATTTTGG + Intergenic
1032480634 7:132243956-132243978 GTGGAGCAATGAATGGCTTAGGG - Intronic
1037832377 8:22197070-22197092 GTGGAGCAAGGGAAGGCTTAGGG + Intronic
1038464752 8:27751209-27751231 CAGCAGCAATGGAAGGGATAAGG + Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1044885863 8:96776352-96776374 GTTCAGGAATGGAGGGTTTAGGG + Intronic
1050080934 9:1915173-1915195 GTTCAGCAATAGAACTCTTAAGG - Intergenic
1050527393 9:6557879-6557901 GTGGAGCAATGGAAGGGTAGAGG + Intronic
1055317061 9:75044258-75044280 TTGTAGCAGTGGAAGGCTAAGGG - Intergenic
1060275490 9:122179300-122179322 GGGGAGCAAGGGAAGGCTTTAGG + Intronic
1062028640 9:134352120-134352142 GTGCAGCAAGGGGAGGGTTCTGG + Intronic
1187201228 X:17135335-17135357 TTGCAGCAGTGGAAGGCTCTTGG - Exonic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1193424589 X:81326955-81326977 TTGCAGCAATGGGAGCATTAGGG + Intergenic
1194306192 X:92252535-92252557 GTGCAGGACTGGAAGTGTTATGG - Intronic
1197782909 X:130174651-130174673 GGCCAGCAATAGAAGGCTTTTGG + Intronic
1198691663 X:139291428-139291450 GGGGTGCAATGGAAGGCTTGAGG + Intergenic