ID: 1115535881

View in Genome Browser
Species Human (GRCh38)
Location 14:34372925-34372947
Sequence TACCAAAGGCCAACACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115535881 Original CRISPR TACCAAAGGCCAACACAGAG AGG (reversed) Intronic
900024800 1:261981-262003 TACCGATGGCCAACACAGGAAGG + Intergenic
900028408 1:351386-351408 TACCGATGGCCAACACAGGAAGG + Intergenic
900685239 1:3944078-3944100 TGACAAAGGCCAAGACACAGTGG - Intergenic
905014817 1:34770499-34770521 TAGCAGAGTCCAACACAGGGTGG - Intronic
906607639 1:47182942-47182964 TGCCAAAGCCCAGCACGGAGGGG + Intergenic
907096622 1:51787339-51787361 TTCCAAAGGCTAAAACAAAGAGG - Exonic
907812003 1:57880119-57880141 TACCTTTGGCAAACACAGAGAGG + Intronic
908253015 1:62280203-62280225 TTCCAAAGGCCAAGACAGGGAGG + Intronic
912451692 1:109771094-109771116 TGCCCAAGACCAACACAGTGCGG + Intronic
915719652 1:157975312-157975334 CTCCAAAGTCCACCACAGAGTGG + Intergenic
917008579 1:170445060-170445082 TACCAAAGGCATACAGAAAGAGG + Intergenic
918066683 1:181106023-181106045 TACCAAAGGAGACCAGAGAGTGG - Intergenic
922576014 1:226661018-226661040 TACCAAAGGCCTTCACTGATCGG + Intronic
922878944 1:228964635-228964657 TTCCACAGGACAACTCAGAGAGG + Intergenic
924576982 1:245289758-245289780 TTCAAAAGACCAACAAAGAGAGG + Intronic
1063494868 10:6497901-6497923 TAGCAAAGGCTATGACAGAGTGG - Intronic
1064062739 10:12152429-12152451 TACCAAATGCGAACACACTGGGG - Intronic
1064724391 10:18263170-18263192 TACAGATGGCCAACCCAGAGTGG + Intronic
1067895794 10:50177686-50177708 TAGCAAAGTCCAGCACACAGTGG - Intergenic
1067953193 10:50764299-50764321 TAGCAAAGTCCAGCACATAGTGG + Intronic
1068021503 10:51591033-51591055 TAACAAAGGCAAACACAGTAGGG + Intronic
1071599951 10:86954202-86954224 TCCCAGTGGCCAACCCAGAGTGG + Intronic
1072031327 10:91525269-91525291 AACCAACGGCCAACCCAGTGGGG + Intergenic
1073609968 10:104933524-104933546 AAGCACAGGCCCACACAGAGAGG + Intronic
1074869227 10:117563997-117564019 CACCAAAGGGCAACCAAGAGGGG - Intergenic
1076068167 10:127465073-127465095 TACCACAGGCCAGCCCACAGAGG + Intergenic
1076231657 10:128824421-128824443 TGCCAGAGGCCAACAGAGAAAGG - Intergenic
1076803177 10:132841985-132842007 CACCAAAAGTCAGCACAGAGAGG - Intronic
1079306423 11:19327592-19327614 TAAAAAAGGCCAACTCAAAGTGG - Intergenic
1081762148 11:45584117-45584139 GACCAGAGGCCAGCACTGAGAGG - Intergenic
1083016241 11:59457302-59457324 TGTCATAGGCCATCACAGAGAGG - Exonic
1085386996 11:76163229-76163251 TAACAATCGCCAACACAGACGGG - Intergenic
1085688833 11:78649510-78649532 TACCAAAGGAGAACTCAGGGAGG - Intergenic
1085938990 11:81185635-81185657 TTCCAGAGGCTAAAACAGAGAGG - Intergenic
1087218646 11:95521952-95521974 TACTAAATCCCAAAACAGAGTGG + Intergenic
1090598920 11:128349433-128349455 TACCACAGTCCTACAGAGAGGGG + Intergenic
1090988710 11:131796496-131796518 AACCGCAGGCCAACACAAAGGGG + Intronic
1094227176 12:28058713-28058735 TACCAAGAGTTAACACAGAGTGG - Intergenic
1095371109 12:41468414-41468436 TACCAAAGCCCAAAACTAAGTGG + Intronic
1096177642 12:49533611-49533633 TACCAAAGGAGAAGACAAAGTGG + Intergenic
1096470826 12:51874580-51874602 CAACAAAGGCATACACAGAGAGG + Intergenic
1096586889 12:52628729-52628751 CACCAAAGGCCCACTGAGAGGGG + Intergenic
1101106013 12:101440826-101440848 TTTCAAATGCCACCACAGAGAGG + Intergenic
1102140448 12:110610664-110610686 CACCAAAGAGCAAGACAGAGTGG + Intergenic
1104227948 12:126854956-126854978 TACCAAGGCACAACTCAGAGAGG + Intergenic
1104829250 12:131737316-131737338 GACCAGTGGCCAGCACAGAGAGG + Intronic
1105567468 13:21564691-21564713 TAACAAAGGCCTGCACAGAAAGG - Intronic
1107073512 13:36297446-36297468 TACCAAAGGCTTACTCAAAGAGG + Intronic
1107733533 13:43372431-43372453 AATCAAAGGATAACACAGAGGGG + Intronic
1107757661 13:43642352-43642374 TACCAATGACCAACTCAGTGTGG - Intronic
1109630051 13:65033775-65033797 TACCAAAGGCAAGAAAAGAGAGG - Intergenic
1110905586 13:80884292-80884314 TTCCAAAAGCCAAGACAAAGAGG - Intergenic
1112332703 13:98488937-98488959 AACCAAAGGCCAAGACCAAGAGG + Intronic
1113342452 13:109440270-109440292 TCCCACAGGGCAACACAGATGGG + Intergenic
1115431942 14:33329431-33329453 ATCCAAACGCCAACCCAGAGAGG - Intronic
1115535881 14:34372925-34372947 TACCAAAGGCCAACACAGAGAGG - Intronic
1117225103 14:53650124-53650146 TACCAAAAGCTAAGACAGTGTGG + Intergenic
1117442888 14:55776810-55776832 TACAAATTGCCAACACAGATTGG - Intergenic
1118920141 14:70142571-70142593 TCTCAAAGGCAAACACAGAAAGG + Intronic
1124903621 15:33847605-33847627 TGCCAAAGGGGAACACAGAAAGG - Intronic
1126685224 15:51242526-51242548 TACGAAAGCACAGCACAGAGTGG + Intronic
1128537888 15:68504318-68504340 TACCAAAGGAAATCTCAGAGGGG + Intergenic
1130583599 15:85160958-85160980 AACCAAAAGCTAACACAAAGAGG + Intergenic
1130851043 15:87793865-87793887 TACCCAGGGCCTACACAAAGAGG - Intergenic
1131582142 15:93654507-93654529 TTCCCAGGGCCAACACAGTGGGG + Intergenic
1135584116 16:23654760-23654782 TACCAAAGGCCAAGAAAGGTAGG - Intronic
1139581949 16:67879037-67879059 TACCAAAGCTCAGCACAGGGTGG - Exonic
1140542154 16:75766629-75766651 TACCAGATGCCAACTTAGAGAGG - Intergenic
1141214719 16:82012264-82012286 TACCAAAGGCAGACTCAGAGAGG + Intergenic
1141469912 16:84231134-84231156 TATCAGGGGCCAGCACAGAGTGG - Intronic
1142456352 16:90227397-90227419 TACCGATGGCCAACACAGGAAGG - Intergenic
1143159229 17:4858227-4858249 TCCAGAAGGCCCACACAGAGAGG - Intronic
1144054723 17:11529645-11529667 TACCAAAGGACAAACCATAGAGG + Intronic
1144088236 17:11830030-11830052 AACCCAAGTCCACCACAGAGAGG - Intronic
1148471207 17:47894728-47894750 TTTCAAAGGCTAACACTGAGAGG + Intergenic
1148898517 17:50855997-50856019 TACCAAAGGGAAAAACATAGAGG - Intergenic
1148953500 17:51335009-51335031 TAACAAAAGTCAAGACAGAGTGG + Intergenic
1149068652 17:52512173-52512195 GTGGAAAGGCCAACACAGAGAGG - Intergenic
1149535874 17:57432916-57432938 TAGCAAAGGGCAACACAGGTTGG - Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1155096003 18:22557307-22557329 TACCAAATACCATCTCAGAGTGG + Intergenic
1155344515 18:24845403-24845425 AACCAAAGGACAACAAAAAGGGG - Intergenic
1156520565 18:37719427-37719449 TCCCAAAGGTCAACATAGAGTGG + Intergenic
1158440166 18:57468229-57468251 TACCAGATGCCAATACAGACAGG - Intronic
1158942115 18:62414327-62414349 TAACATTGGCCAACACAGTGTGG - Intergenic
1164413012 19:28021211-28021233 TTCCAAATGCCTCCACAGAGAGG + Intergenic
1164517507 19:28948625-28948647 TTCCAAATGCCTCCACAGAGAGG + Intergenic
1164546567 19:29169971-29169993 CACCAAAGCCCAGCTCAGAGAGG + Intergenic
1167243936 19:48362771-48362793 TACCCAAGGCCACAACATAGTGG - Intronic
1168312920 19:55470275-55470297 TAGCAAAGTCCCACACTGAGTGG - Intergenic
926259282 2:11242452-11242474 TACCAAAGCCCAAGTGAGAGAGG + Intronic
928010470 2:27602809-27602831 TACCAAAGTCCAGCACAGTGAGG - Intronic
928917933 2:36493422-36493444 TACCAGAGGACAGCACAGTGAGG + Intronic
929381846 2:41363318-41363340 CAGCAAAGGCCAAAACTGAGTGG + Intergenic
929648871 2:43657530-43657552 AACCAAAGCCCATCACAGGGTGG + Intronic
930741460 2:54836579-54836601 CCACAAAGGCCACCACAGAGTGG - Intronic
932022596 2:68102861-68102883 TACAAAAGCCCATCACACAGTGG + Intronic
933628965 2:84634941-84634963 CTCCAAAGGTCAACACAGAGTGG - Intronic
935182761 2:100705217-100705239 TACCATCCCCCAACACAGAGTGG + Intergenic
941568810 2:167143087-167143109 TATCAGAGGCGAACACAGAATGG + Intronic
946960879 2:224984531-224984553 TAACAGAGGCTAACAGAGAGAGG - Intronic
947039896 2:225905328-225905350 TACCAATGACCAGCAGAGAGGGG - Intergenic
947318981 2:228896015-228896037 CACCAAAAGGCAACACAGAGGGG - Intronic
949087845 2:242172191-242172213 TACCGATGGCCAACACAGGAAGG - Intergenic
1175240607 20:57545474-57545496 TAATAAAAGCCAACACAGAGGGG + Intergenic
1177512573 21:22109004-22109026 TACCAAAGAACAAGACAGATTGG + Intergenic
1178375369 21:32062752-32062774 AACCAAACGCCAAGTCAGAGTGG + Intergenic
1183091744 22:35526972-35526994 GACCCAAGGCCAGCAAAGAGTGG - Intergenic
1183475134 22:38031937-38031959 AAACAGAGGCCAAGACAGAGGGG - Intronic
949575208 3:5332139-5332161 TGGCACAGGCTAACACAGAGTGG - Intergenic
950298836 3:11856355-11856377 TACAAAAGGATAACACAGGGAGG - Intergenic
951607901 3:24457201-24457223 TACCACAGGACAATACTGAGGGG + Intronic
952416499 3:33095575-33095597 TACCTGAGGCCCACACAGGGAGG - Intronic
953372633 3:42402845-42402867 TACCAAATGCCCACAAATAGAGG + Intronic
954716844 3:52531210-52531232 TTCCCCAGGCCAGCACAGAGCGG + Intronic
955754811 3:62216429-62216451 TACCCAAGGGCTTCACAGAGTGG + Intronic
961906084 3:130264315-130264337 GACCCAAGGCCAGCACAAAGAGG - Intergenic
963391804 3:144674245-144674267 TCCCAAAGGCCATCACAATGGGG - Intergenic
965455526 3:168894951-168894973 CAACAGATGCCAACACAGAGAGG + Intergenic
965525465 3:169712103-169712125 TCCCACAGGTCAACACAAAGAGG + Intergenic
967263269 3:187666476-187666498 TAGCAAAGGCAAAGAAAGAGAGG + Intergenic
968800916 4:2742837-2742859 GCCCACAGGCCACCACAGAGTGG + Intronic
970498261 4:16650191-16650213 TGGGAAAGCCCAACACAGAGAGG - Intronic
972099906 4:35401929-35401951 AACCAAAAGCCAAAACTGAGTGG + Intergenic
972379112 4:38502540-38502562 TACCAAAAACCAACACACATTGG + Intergenic
975701350 4:77069787-77069809 TACCAAAACCCCACACACAGTGG - Intronic
977325011 4:95564122-95564144 TTTCAAAGGCCTACACAGACAGG - Intergenic
977453862 4:97233133-97233155 TACCAGAAGAAAACACAGAGAGG + Intronic
979718999 4:123876751-123876773 TCTCAAAGGCCAAGCCAGAGTGG - Intergenic
988508594 5:31846089-31846111 AACCCAAAGCCACCACAGAGGGG - Intronic
988802482 5:34709560-34709582 TTCCAAATGTCAACAGAGAGGGG - Intronic
988968037 5:36439623-36439645 CACAAAAGGCCAAGCCAGAGGGG + Intergenic
990027895 5:51218132-51218154 TAAAAATGTCCAACACAGAGTGG + Intergenic
992739812 5:79762452-79762474 TAAGAAAGGCTAACATAGAGAGG + Intronic
993579319 5:89639669-89639691 CACCAAAGTACCACACAGAGGGG - Intergenic
993930704 5:93935271-93935293 TACTACAGGAAAACACAGAGGGG + Intronic
997803334 5:136888846-136888868 GAACAAAGGCCAAGGCAGAGAGG - Intergenic
1002074917 5:176702749-176702771 TAACTAATGCAAACACAGAGAGG + Intergenic
1002745582 5:181468985-181469007 TACCGATGGCCAACACAGGAAGG - Intergenic
1005271004 6:24163624-24163646 TACCAAAGGCCATAGCACAGTGG - Intergenic
1007941882 6:45789217-45789239 TATCAAAGGCCAACTAGGAGTGG + Intergenic
1008497810 6:52150983-52151005 TTCCAAAGGGCAGCACAGAATGG + Intergenic
1010272145 6:73926820-73926842 CACCAAAGGCAAAAAGAGAGAGG + Intergenic
1012655257 6:101809553-101809575 TATCAAATGCCACCAAAGAGAGG - Intronic
1013048867 6:106512590-106512612 TACCAAAGGGCAGCTCCGAGGGG + Exonic
1016075387 6:139789080-139789102 TAGAAGAGGCCAACAGAGAGGGG + Intergenic
1018816544 6:167336901-167336923 CCCCCAAGGCCCACACAGAGGGG - Intronic
1018831388 6:167446385-167446407 TACCAGAGGCCCCCACAGATGGG + Intergenic
1019250499 6:170742540-170742562 TACCGATGGCCAACACAGGAAGG - Intergenic
1029513916 7:101014093-101014115 CACCGCAGGCCCACACAGAGGGG + Intronic
1030150861 7:106403678-106403700 CAACAATGGCCAATACAGAGAGG - Intergenic
1032576493 7:133060417-133060439 TACCACAGGCCCACACAGGTGGG + Intronic
1032996574 7:137453457-137453479 GACCAAAAGCAAACAAAGAGAGG - Intronic
1034872092 7:154694149-154694171 TTACAAAAGACAACACAGAGGGG - Intronic
1036062685 8:5341976-5341998 ACCCAGAGGCCAACACACAGAGG - Intergenic
1037163546 8:15799927-15799949 TCCCACAGGGCAACACAAAGAGG + Intergenic
1037517760 8:19650625-19650647 TGCCAGAGGCCAGCACAGTGGGG + Intronic
1038515245 8:28182608-28182630 AACCAAAGGCCAAAAAAAAGGGG - Intronic
1038624834 8:29181211-29181233 TTCCAGTGGTCAACACAGAGAGG - Intronic
1038658157 8:29473107-29473129 CCCCAGAGGCCAACACAGAGTGG - Intergenic
1044701256 8:94967284-94967306 AATGCAAGGCCAACACAGAGGGG - Intronic
1045131074 8:99153389-99153411 CACAAAAGGCCAAAAAAGAGCGG - Intronic
1046121231 8:109849296-109849318 AAAAAAAGACCAACACAGAGAGG - Intergenic
1050103321 9:2140981-2141003 TACCAAAGGCCGGTTCAGAGAGG - Intronic
1050515914 9:6444567-6444589 TACCCAAGGCCCACACAATGAGG - Intronic
1050930271 9:11313335-11313357 TACACCAGGCCTACACAGAGAGG - Intergenic
1051551190 9:18331372-18331394 AACCATAGGCCAACACAGTGGGG - Intergenic
1055531100 9:77184848-77184870 TACCAAAGTCCACAACAGGGAGG + Intronic
1056343590 9:85665477-85665499 TAACAAAGTCCAATACTGAGTGG - Intronic
1060482289 9:124023657-124023679 TCCCCAAGGCCAACAGAGACTGG - Intronic
1061366593 9:130175186-130175208 TACTAAAGGCCAACACATGGGGG - Intronic
1061524153 9:131144419-131144441 AACCAAAGGAGAACACAGTGGGG - Exonic
1203580054 Un_KI270745v1:35139-35161 TACCGATGGCCAACACAGGAAGG - Intergenic
1185560248 X:1055465-1055487 TACCAAAGGCCAGAAGAGAAAGG + Intergenic
1187841887 X:23497510-23497532 TACCAAAAGACAACACTGAGAGG - Intergenic
1192178831 X:68902826-68902848 TTCCTAAGGGCAACACAGAGGGG + Intergenic
1192236918 X:69301938-69301960 TACCACAGGCCACAACAGGGAGG + Intergenic
1193558700 X:82990248-82990270 TACCAAAAGACTACACAAAGAGG - Intergenic
1195054669 X:101132232-101132254 CAACAAAGGCCATCCCAGAGAGG - Exonic
1196768289 X:119269638-119269660 CCTCAAATGCCAACACAGAGTGG + Intergenic
1198739002 X:139820621-139820643 TACCAAAGCGCAGCCCAGAGTGG - Intronic
1200865213 Y:8036306-8036328 TACCAAAGTCCTGCCCAGAGAGG + Intergenic