ID: 1115543767

View in Genome Browser
Species Human (GRCh38)
Location 14:34446647-34446669
Sequence ATGCCCTTCTAGAAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 2, 1: 13, 2: 53, 3: 53, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115543767_1115543771 2 Left 1115543767 14:34446647-34446669 CCTTCCCTCTTCTAGAAGGGCAT 0: 2
1: 13
2: 53
3: 53
4: 196
Right 1115543771 14:34446672-34446694 GTTATTTGGCTCTTTTTCCATGG 0: 1
1: 0
2: 1
3: 20
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115543767 Original CRISPR ATGCCCTTCTAGAAGAGGGA AGG (reversed) Intronic
901225136 1:7608930-7608952 ATGTCCTTCTAGAAAAGGCCAGG - Intronic
904437944 1:30511459-30511481 ATGCCCTGTTAGCAGGGGGAGGG + Intergenic
905084926 1:35364494-35364516 ATACTCTTCTAAAAGAAGGAGGG - Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
906951753 1:50340708-50340730 CTGTGATTCTAGAAGAGGGATGG - Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
913490211 1:119372639-119372661 ATTCCCTTTTACAAGAGGTACGG - Intronic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918409248 1:184241382-184241404 ATGCCATTCTCCAAGAAGGAAGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919195394 1:194278520-194278542 AGGCCCTTCTTGAAGGTGGAGGG + Intergenic
920443870 1:206001044-206001066 CTGCCCTTCTAGGATAGGGTAGG - Intronic
921427703 1:215023293-215023315 ATGCCTTTGTAGTAGAGGGCTGG - Intronic
921587755 1:216967447-216967469 ATGTCTTTCTAGAAAAGGCAGGG - Intronic
922117693 1:222630401-222630423 ATGGCCTTGTAGAACAGGGCTGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922512691 1:226182757-226182779 ATGCCATTCCAGAGGGGGGAAGG - Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066105385 10:32151914-32151936 ATGCTGTAATAGAAGAGGGAAGG - Intergenic
1066470361 10:35691766-35691788 CTGCCCTAATAGAACAGGGAAGG + Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1067035786 10:42915541-42915563 ATACCCTTCAAGAAAAAGGAAGG - Intergenic
1067570037 10:47365010-47365032 TTCCACATCTAGAAGAGGGAAGG - Intergenic
1067776603 10:49168769-49168791 AGGCCTGGCTAGAAGAGGGAGGG - Intronic
1069801058 10:71081812-71081834 ATGCCCTTCGAAAAGAGGCTTGG - Intergenic
1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG + Exonic
1074336016 10:112576320-112576342 TGGCCCTTTTAGAAGAGGCAGGG - Intronic
1074431946 10:113401785-113401807 AGGCCCATCTAGGAGAAGGAGGG - Intergenic
1074669890 10:115778308-115778330 ATGGCCTATTAGAAGAGGTAAGG + Intronic
1074708254 10:116155345-116155367 TTCCCCCTCTAGCAGAGGGAAGG + Intronic
1077991268 11:7414452-7414474 CTGCCCTTACTGAAGAGGGAAGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078749248 11:14144209-14144231 ATACCCTTTTAGAAGATGGAAGG - Intronic
1079240772 11:18720987-18721009 AGGCCCTTCGAGGAAAGGGAGGG - Intronic
1079619522 11:22536152-22536174 AAGGCTTTCTAGAAGAGGTAAGG - Intergenic
1079755940 11:24262208-24262230 ATGCCCTTATAAAAGAGGACTGG - Intergenic
1080604001 11:33848949-33848971 ATGTCGTTTTAGAGGAGGGAGGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1084336679 11:68461530-68461552 ATGGGCTTCTTTAAGAGGGAGGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086400675 11:86458908-86458930 ATGACCTTGTTGGAGAGGGAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088503609 11:110508024-110508046 AGGCCCTTCTAGGAGCAGGAGGG - Intergenic
1089705058 11:120271823-120271845 AACCCCTCCCAGAAGAGGGAGGG - Intronic
1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG + Intergenic
1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091721243 12:2815540-2815562 AGGCCTTGCTAGAGGAGGGAAGG + Intronic
1092095902 12:5841680-5841702 AGAACCTTCCAGAAGAGGGAAGG - Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1099091505 12:78316187-78316209 ATGCCCTTCTAGGAAGGGAAGGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102616145 12:114156065-114156087 ATGCCCATCTCCAAGGGGGATGG + Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1107960042 13:45549318-45549340 ATGACCACTTAGAAGAGGGAGGG + Intronic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1112871578 13:103977559-103977581 ATGAACTACTAGAGGAGGGAAGG + Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1120744010 14:88137580-88137602 ATGCCCTACCAGATGGGGGATGG - Intergenic
1121265093 14:92596611-92596633 ATCCCCTGCTAAAAGAGGAACGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1123540670 15:21286541-21286563 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1124816839 15:33002210-33002232 ATGCCTTTCTAGAATAAGAAGGG - Intronic
1124858414 15:33413158-33413180 ATGCCGTTTGAGAAAAGGGAGGG + Intronic
1125747178 15:42004974-42004996 ATGCCCTGGTAGGGGAGGGAGGG + Exonic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1130725368 15:86433377-86433399 AGCCCCTTCTAGAAGGAGGAAGG + Intronic
1131057584 15:89384725-89384747 ATGATCTTCTGGAGGAGGGAAGG + Intergenic
1131362182 15:91803057-91803079 ATGGCCTTCCTGCAGAGGGACGG + Intergenic
1132152354 15:99471490-99471512 ATGCCCTTCTACATTGGGGAGGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1202948981 15_KI270727v1_random:13684-13706 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1132598116 16:762392-762414 CTGCCCTTCTGGGAGAGGGGTGG + Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1135207954 16:20499032-20499054 ATGCCCTTCTTGCAGTGGCAGGG - Intergenic
1135210945 16:20524668-20524690 ATGCCCTTCTTGCAGTGGCAGGG + Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1138231936 16:55344166-55344188 ATGCTCTTCTACAAGAAGGGAGG + Intergenic
1140231847 16:73123805-73123827 ATGCCCTTATAGAAGAGGCCTGG + Intergenic
1142157491 16:88539269-88539291 GTGCCCTCCTGGAAGAAGGAGGG - Intergenic
1142426042 16:90002861-90002883 CTTCCCTTCTGGCAGAGGGAGGG - Intergenic
1142485362 17:244298-244320 ATGCCCTGTTGGAAGAGGAAGGG - Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147356965 17:39905836-39905858 ATGCCCTGCTAGGTGAGGAAGGG - Exonic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1149659544 17:58327122-58327144 AGGCTCCTGTAGAAGAGGGAAGG - Intronic
1151909697 17:77073924-77073946 CTGTCATTCTAGTAGAGGGAGGG - Intergenic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1153261193 18:3226005-3226027 TTGCACTTCGAGAAGAGAGATGG + Intergenic
1153867975 18:9290793-9290815 ATGCCCTTGGCCAAGAGGGAGGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1159013311 18:63080231-63080253 ACTGCCTTCTGGAAGAGGGAGGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1162933440 19:13968654-13968676 AAGCCCATCCAGAAGATGGAAGG - Exonic
1163617372 19:18337459-18337481 GTGCGTTGCTAGAAGAGGGAAGG - Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1165043726 19:33087560-33087582 GTGACGTTCTAGAAGAGGTATGG + Intronic
1165327821 19:35124562-35124584 GTGCCCTTCTAGATGGGCGACGG - Exonic
1166549845 19:43657900-43657922 ATGCCCTTAAAGAATAGGGCTGG + Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928847087 2:35689267-35689289 ATGGTCTTCTGGAAGAGAGAGGG - Intergenic
929278449 2:40050927-40050949 ATGCCACTCTAGTAGAGGGAGGG + Intergenic
929823293 2:45290492-45290514 ATGACCTGCTAGATGAGAGAGGG + Intergenic
932069803 2:68608079-68608101 ATGGACTACTAGCAGAGGGAGGG - Intronic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933548465 2:83743502-83743524 AGGCCCTTTTAGAAGGAGGAAGG - Intergenic
935238812 2:101160728-101160750 ATGCCATTCTAGGAGGGGGAGGG + Intronic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG + Exonic
939882202 2:147643216-147643238 ATATCCTTCTAGAAGAGGAGGGG - Intergenic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
941097956 2:161262324-161262346 ATGCCCTTATAGATGAGGTTGGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944606331 2:201354818-201354840 CTGGCCTTCAAGAAGAGAGAAGG - Intronic
945254274 2:207790885-207790907 CTGCCCTTCTGGAATAGGGGAGG + Intergenic
947004971 2:225500754-225500776 TTGACCTTCTAGCAGAGAGATGG - Intronic
947087301 2:226467644-226467666 AAGCACTGCTAGAAAAGGGATGG - Intergenic
947732204 2:232437485-232437507 GGGCCCTTCCAGCAGAGGGATGG + Intergenic
1170112621 20:12822149-12822171 ATGCCCTGCTAGGGTAGGGAAGG - Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173427534 20:42955987-42956009 ATTCCCTTCCAGGAGAGGAAGGG + Intronic
1174961803 20:55166152-55166174 CTGCCCTTCAAGATGAGAGAAGG - Intergenic
1175078115 20:56392868-56392890 AGGCCCTTCGAGAAGAGGAAGGG - Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177534700 21:22408572-22408594 ATGACATTCTATGAGAGGGATGG + Intergenic
1179381601 21:40904196-40904218 AGGTCCTGCTAGAAAAGGGAGGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1182751030 22:32642330-32642352 TTGCCCTTCTAGAAAATGGTTGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951071413 3:18332973-18332995 TTGCCCTTCTAGGAATGGGAAGG - Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
951942075 3:28090502-28090524 GTGCCCTTGTAAAAGAGGGCTGG + Intergenic
953473590 3:43186918-43186940 ATGGCCCTCCAGAACAGGGAGGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959776949 3:110176856-110176878 ATGCCCTTATAAAAGAGAAAGGG - Intergenic
960544848 3:118902458-118902480 ATGCCCTCATACAAGGGGGAGGG - Exonic
961597360 3:128029080-128029102 AAGACCTTGGAGAAGAGGGAAGG - Intergenic
961626319 3:128266371-128266393 ATGCTGCTCTAGATGAGGGATGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964439981 3:156698214-156698236 TTGCACTTCTATAAGAGAGATGG - Intronic
964632657 3:158829422-158829444 ATGCCCTACTAGTAAAAGGAAGG - Exonic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965340755 3:167488381-167488403 ATGGACTACTAGAACAGGGATGG + Intronic
965564563 3:170100158-170100180 ATGCCCTGGTTAAAGAGGGAAGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969449668 4:7265849-7265871 ATTCCCTTCCTGCAGAGGGAGGG + Intronic
969603996 4:8193168-8193190 AGGTCGTTCTAGAAGAGGGGAGG - Intronic
972078078 4:35111661-35111683 ATCCCATTCTAGAAGAGAGTTGG + Intergenic
972670237 4:41208150-41208172 ATGCCATTGTTGAAGAAGGAAGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974351201 4:60749206-60749228 ATGCCCATCTACATTAGGGAGGG + Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975895897 4:79089816-79089838 ATGCACTTCTAAAAGAAGTAAGG - Intergenic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
977409635 4:96645408-96645430 AAGGACTACTAGAAGAGGGAGGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
982731723 4:158963457-158963479 ATGCCCAGCTAGTAGAGAGAGGG + Intronic
983599585 4:169511230-169511252 AGGGCCTTCTTGAAGAGGGGAGG - Intronic
987682177 5:21151221-21151243 ATGTCCTTCTTTATGAGGGATGG + Intergenic
988227629 5:28432768-28432790 ATTCCCTTCTGGCAGTGGGAGGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993946807 5:94124767-94124789 CTGCCCTTGAAGAAGAGGGATGG + Intergenic
994117499 5:96077584-96077606 ATGCCCTTCCTGATGAGGGGAGG + Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
997385651 5:133470029-133470051 ATGCCCTTCCAGAGTATGGAAGG - Intronic
997572779 5:134944827-134944849 ATGCCCTTGCTGAAGAGAGAAGG + Intronic
997631856 5:135374597-135374619 ATGCCTTCCTACAAGGGGGAGGG + Intronic
997813333 5:136993407-136993429 ATGCCCTGAGGGAAGAGGGAGGG - Intronic
999018085 5:148131203-148131225 ATGGCATTCAAGAAGAGGGGTGG - Intronic
1000021866 5:157325186-157325208 ATGGCTTTGTAGGAGAGGGATGG + Intronic
1000445153 5:161310151-161310173 AGGGCCTTCTAGAGGATGGAGGG + Intronic
1001514086 5:172342846-172342868 TGGCCCTTCTGGGAGAGGGATGG + Intronic
1001604924 5:172952756-172952778 ATTCACTTCTAGAGGAGAGAAGG + Intergenic
1003713021 6:8614544-8614566 ATTCCCTTCTAGAAGGTGTAGGG - Intergenic
1005049197 6:21667530-21667552 ACGCCCGTCCAAAAGAGGGATGG + Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG + Intronic
1006672898 6:35740729-35740751 ATGCCCTGCTAGAATATGCAAGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007095020 6:39207731-39207753 CTGCCCTTCCAGCAGTGGGAAGG + Intronic
1007203570 6:40131337-40131359 CTGCCCTTCCTGCAGAGGGATGG + Intergenic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012807387 6:103911658-103911680 CTTTCCTTCTAGTAGAGGGAGGG + Intergenic
1013006881 6:106081987-106082009 AAGCCATTCTGGAAGAGGGGAGG - Intergenic
1013183628 6:107738680-107738702 CTTCCCTTGAAGAAGAGGGAGGG - Intronic
1013620565 6:111884280-111884302 ATGCCCTTCTACATTAGAGAGGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015058053 6:128928546-128928568 AAGCCGTTCAAGGAGAGGGAAGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016187666 6:141217954-141217976 ATTTCCTTCTAGTATAGGGAGGG + Intergenic
1016813946 6:148286664-148286686 GTGTCCTTCTAGAAGAGGAGGGG - Intronic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020564310 7:9776938-9776960 ATGCACTGCTGGAAGAGGAAGGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1022617966 7:31951876-31951898 ATCTCCTTGTGGAAGAGGGAAGG - Intronic
1026734303 7:72939794-72939816 ATCCATTTCTGGAAGAGGGAAGG + Intronic
1026784635 7:73294702-73294724 ATCCATTTCTGGAAGAGGGAAGG + Intergenic
1027109435 7:75425226-75425248 ATCCATTTCTGGAAGAGGGAAGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027760599 7:82274150-82274172 ATGCCATTCTAGGAAAAGGAGGG - Intronic
1028835069 7:95365764-95365786 ATGCCTTGCTGGAAGAGGCAAGG - Intronic
1029441102 7:100586943-100586965 ATGCCCAGCTCGAGGAGGGAGGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030314862 7:108104236-108104258 GCACCCTTCTAGTAGAGGGATGG - Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033620970 7:143061780-143061802 ATGACTTTCTATAAGAGGGTTGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1036204065 8:6792653-6792675 AGGCCCTTTTAGAAGAGGCTTGG + Intergenic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1041989704 8:63971927-63971949 CTGCTGTTCTAGGAGAGGGAGGG - Intergenic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1044129986 8:88509788-88509810 ATGCCCTCCTTGATGGGGGATGG + Intergenic
1044964274 8:97560041-97560063 ATGCCTTCCTAAAAGAGGTATGG + Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046222827 8:111237736-111237758 ATGCACCCCTATAAGAGGGAGGG - Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1048116567 8:131530822-131530844 ATGCCCTGTTAGAAAAGGTAGGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051744820 9:20285512-20285534 ATGCTCTTCTACTTGAGGGAGGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058123863 9:101169416-101169438 ATGCCCTTCTAGTCTGGGGATGG + Intronic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1190521459 X:51282131-51282153 ATGACCTTCTATACGTGGGAGGG - Intergenic
1192843339 X:74880381-74880403 ATGGCCTAAGAGAAGAGGGAAGG + Intronic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG + Intergenic
1196254864 X:113505321-113505343 GTGGCCTAGTAGAAGAGGGAGGG - Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196542576 X:116926451-116926473 ATGCTCTTGTAGAAGAGCAAAGG + Intergenic
1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG + Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic