ID: 1115544881

View in Genome Browser
Species Human (GRCh38)
Location 14:34456754-34456776
Sequence CAGGTGTGTGCCACCACGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446037
Summary {0: 1003, 1: 11586, 2: 54198, 3: 150376, 4: 228874}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115544881_1115544888 4 Left 1115544881 14:34456754-34456776 CCGGGCGTGGTGGCACACACCTG 0: 1003
1: 11586
2: 54198
3: 150376
4: 228874
Right 1115544888 14:34456781-34456803 CCCAGCTACTCGGGAGGGCAAGG 0: 2
1: 459
2: 6629
3: 121287
4: 305111
1115544881_1115544886 -1 Left 1115544881 14:34456754-34456776 CCGGGCGTGGTGGCACACACCTG 0: 1003
1: 11586
2: 54198
3: 150376
4: 228874
Right 1115544886 14:34456776-34456798 GTAGTCCCAGCTACTCGGGAGGG 0: 422
1: 2132
2: 4543
3: 4500
4: 3857
1115544881_1115544885 -2 Left 1115544881 14:34456754-34456776 CCGGGCGTGGTGGCACACACCTG 0: 1003
1: 11586
2: 54198
3: 150376
4: 228874
Right 1115544885 14:34456775-34456797 TGTAGTCCCAGCTACTCGGGAGG 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
1115544881_1115544882 -6 Left 1115544881 14:34456754-34456776 CCGGGCGTGGTGGCACACACCTG 0: 1003
1: 11586
2: 54198
3: 150376
4: 228874
Right 1115544882 14:34456771-34456793 CACCTGTAGTCCCAGCTACTCGG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
1115544881_1115544891 27 Left 1115544881 14:34456754-34456776 CCGGGCGTGGTGGCACACACCTG 0: 1003
1: 11586
2: 54198
3: 150376
4: 228874
Right 1115544891 14:34456804-34456826 CGGAACAATTGCTTGAATCCAGG 0: 1
1: 6
2: 321
3: 7347
4: 57525
1115544881_1115544890 7 Left 1115544881 14:34456754-34456776 CCGGGCGTGGTGGCACACACCTG 0: 1003
1: 11586
2: 54198
3: 150376
4: 228874
Right 1115544890 14:34456784-34456806 AGCTACTCGGGAGGGCAAGGCGG 0: 1
1: 55
2: 974
3: 11030
4: 47618
1115544881_1115544892 30 Left 1115544881 14:34456754-34456776 CCGGGCGTGGTGGCACACACCTG 0: 1003
1: 11586
2: 54198
3: 150376
4: 228874
Right 1115544892 14:34456807-34456829 AACAATTGCTTGAATCCAGGAGG 0: 1
1: 212
2: 4560
3: 34338
4: 87385
1115544881_1115544883 -5 Left 1115544881 14:34456754-34456776 CCGGGCGTGGTGGCACACACCTG 0: 1003
1: 11586
2: 54198
3: 150376
4: 228874
Right 1115544883 14:34456772-34456794 ACCTGTAGTCCCAGCTACTCGGG 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115544881 Original CRISPR CAGGTGTGTGCCACCACGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr