ID: 1115544890

View in Genome Browser
Species Human (GRCh38)
Location 14:34456784-34456806
Sequence AGCTACTCGGGAGGGCAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59678
Summary {0: 1, 1: 55, 2: 974, 3: 11030, 4: 47618}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115544881_1115544890 7 Left 1115544881 14:34456754-34456776 CCGGGCGTGGTGGCACACACCTG 0: 1003
1: 11586
2: 54198
3: 150376
4: 228874
Right 1115544890 14:34456784-34456806 AGCTACTCGGGAGGGCAAGGCGG 0: 1
1: 55
2: 974
3: 11030
4: 47618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115544890 Original CRISPR AGCTACTCGGGAGGGCAAGG CGG Intronic
Too many off-targets to display for this crispr