ID: 1115545455

View in Genome Browser
Species Human (GRCh38)
Location 14:34462026-34462048
Sequence CCGCGGGGCCGCATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115545455_1115545460 -5 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545455_1115545470 14 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545470 14:34462063-34462085 CCGGCCCCCGCGCGCGCGGCCGG 0: 1
1: 0
2: 6
3: 49
4: 399
1115545455_1115545467 10 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545467 14:34462059-34462081 CAGCCCGGCCCCCGCGCGCGCGG 0: 1
1: 1
2: 3
3: 22
4: 272
1115545455_1115545475 20 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545475 14:34462069-34462091 CCCGCGCGCGCGGCCGGGACAGG 0: 1
1: 0
2: 3
3: 29
4: 309
1115545455_1115545471 15 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545471 14:34462064-34462086 CGGCCCCCGCGCGCGCGGCCGGG 0: 1
1: 0
2: 4
3: 57
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115545455 Original CRISPR CCGCGGGGCCGCATTTCCCC AGG (reversed) Intronic