ID: 1115545455

View in Genome Browser
Species Human (GRCh38)
Location 14:34462026-34462048
Sequence CCGCGGGGCCGCATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115545455_1115545470 14 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545470 14:34462063-34462085 CCGGCCCCCGCGCGCGCGGCCGG 0: 1
1: 0
2: 6
3: 49
4: 399
1115545455_1115545475 20 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545475 14:34462069-34462091 CCCGCGCGCGCGGCCGGGACAGG 0: 1
1: 0
2: 3
3: 29
4: 309
1115545455_1115545467 10 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545467 14:34462059-34462081 CAGCCCGGCCCCCGCGCGCGCGG 0: 1
1: 1
2: 3
3: 22
4: 272
1115545455_1115545460 -5 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545455_1115545471 15 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545471 14:34462064-34462086 CGGCCCCCGCGCGCGCGGCCGGG 0: 1
1: 0
2: 4
3: 57
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115545455 Original CRISPR CCGCGGGGCCGCATTTCCCC AGG (reversed) Intronic
900786909 1:4655176-4655198 CCGCGGGGGCGCACATCCTCCGG - Exonic
901026754 1:6282384-6282406 CCGCAGGGCAGCACTTGCCCCGG - Intronic
904133977 1:28296818-28296840 CCGCCAGGCAGCATCTCCCCTGG + Intergenic
905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG + Exonic
906678491 1:47709647-47709669 CCGCGGGGCCGCCCCTCCCCCGG + Intergenic
915517158 1:156420301-156420323 CCGTGAGGCCGGCTTTCCCCGGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918216031 1:182392218-182392240 CCCTGGTTCCGCATTTCCCCAGG - Intergenic
1075438307 10:122461099-122461121 CCGCGGTGCCGCAACGCCCCGGG + Intergenic
1075721664 10:124591084-124591106 CCGCGGTGCCCCCTTCCCCCCGG - Intronic
1076872440 10:133200570-133200592 CAGCGGGGCTGCCTTTGCCCCGG + Intronic
1079953459 11:26833257-26833279 CAGCAGGGCTGCATTTCACCTGG - Intergenic
1091974067 12:4810759-4810781 CCCCCGGTCCCCATTTCCCCAGG - Exonic
1095261715 12:40105829-40105851 CCGCGGAGCCGCGTCCCCCCGGG - Exonic
1113464467 13:110503954-110503976 CCCTGGGGCCCCATCTCCCCCGG - Exonic
1115545455 14:34462026-34462048 CCGCGGGGCCGCATTTCCCCAGG - Intronic
1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG + Intergenic
1122363974 14:101183474-101183496 ACGAGGGGCTGCTTTTCCCCAGG + Intergenic
1124121438 15:26892353-26892375 CCACGGGGCTGCATTTCCCCGGG - Intronic
1124249320 15:28096843-28096865 CCGCGGGGCCGCCAGTCCCGGGG - Intronic
1128161031 15:65422950-65422972 CCGCGGCGCCGCGCCTCCCCGGG - Exonic
1129414591 15:75368265-75368287 CGGTGGGGCCGCACTTTCCCTGG + Intronic
1133271886 16:4614434-4614456 CCGCGGGGCCGCGAGTCCCCCGG - Intronic
1135988738 16:27204098-27204120 CCCCGGGGCTGCATTTCTCGCGG - Exonic
1140095062 16:71868070-71868092 CAGCTGGGCAGCATATCCCCAGG + Intronic
1141134657 16:81457604-81457626 CCGGGGGGCCACATTACCCCTGG + Intronic
1142474301 17:180519-180541 CCGCGGGGCCGCTTGTCCTTTGG - Intronic
1147246362 17:39123758-39123780 CAGCGGGGCAGCATTTACCTTGG + Intronic
1158574978 18:58629147-58629169 CCCTGGGGCTGCATTTCACCAGG - Intergenic
1158953944 18:62522904-62522926 CTGGGGGGCCGCCTTTCTCCAGG - Intergenic
1160329271 18:77977386-77977408 CCCTGGGGCTGCATCTCCCCAGG - Intergenic
1160411166 18:78676385-78676407 CCGCAATGCCGCATTTCTCCAGG + Intergenic
1160411198 18:78676610-78676632 CCGCAATGCCGCATTTCTCCAGG + Intergenic
1161265265 19:3360783-3360805 CCGCGGAGCCGCGTGTCCCTGGG + Intronic
1161428493 19:4217410-4217432 CCGCGGCCTCGCACTTCCCCAGG - Exonic
1161495577 19:4584234-4584256 CCGCTGGGCCTCAGTTTCCCCGG + Intergenic
1161950827 19:7466983-7467005 CCGCGGGTCTCCATCTCCCCAGG + Intronic
927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG + Intergenic
928200934 2:29247154-29247176 CCGCGGCAGCGCCTTTCCCCCGG + Intronic
936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG + Intronic
938128997 2:128694615-128694637 CTGCGGGGCAGCATCACCCCAGG - Intergenic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
1172569138 20:35955077-35955099 CCACAGAGCCGCATTTCCCTTGG - Exonic
1173891385 20:46513615-46513637 CCCCCGGGCCGCCTTTCCCGGGG + Intergenic
1174412240 20:50343672-50343694 CCGCGGGGCGGCCTCTCCACAGG - Intergenic
1174518656 20:51113140-51113162 CAGCAGGGCCGCAGTCCCCCTGG + Intergenic
1175443214 20:59004854-59004876 CAGCCCTGCCGCATTTCCCCAGG - Intronic
1176156943 20:63626811-63626833 CCGCGCGGCCGCCCCTCCCCCGG + Intronic
1183246802 22:36700087-36700109 CAGCGGGGCCTCACTACCCCCGG - Intronic
1183478956 22:38052492-38052514 CCGGGTGGCAGCACTTCCCCAGG + Intergenic
1184116860 22:42427241-42427263 CTCCGGGTCCACATTTCCCCAGG + Intronic
1184333066 22:43838146-43838168 CCGCTGGGCCACCTTTCCCTTGG - Intronic
950420961 3:12899281-12899303 CCGCGGGGCCGCGTTCCCAGTGG - Exonic
957811544 3:85228918-85228940 CCACAGGTCCGCCTTTCCCCAGG + Intronic
960619693 3:119626202-119626224 CAGAGGGGCCGCACTTCCCATGG - Intronic
961170900 3:124797080-124797102 CCGCAGGGGCCCATTTCCTCAGG - Intronic
982564592 4:156971681-156971703 CCGAGCGGCCGAATTGCCCCAGG - Intergenic
986317691 5:6601555-6601577 CCGAGGGGCCACATGTCCTCAGG - Intronic
999271371 5:150298141-150298163 CCGCCGGGCCACATTGCCCATGG + Exonic
1008488770 6:52063774-52063796 CCGAGGGGCAACATTGCCCCTGG + Intronic
1018743697 6:166748578-166748600 CCTCGGGCCCCCATTTCCTCAGG + Intronic
1018744095 6:166749553-166749575 CCTCGGGCCCCCATTTCCTCAGG + Intronic
1023141757 7:37109176-37109198 CCACGTGGCCGCATTGTCCCTGG - Intronic
1027152053 7:75739566-75739588 CCGCGGGGCTGCGCTTTCCCGGG - Intergenic
1030629118 7:111875749-111875771 CAGCAGGGCTGCATTCCCCCTGG - Intronic
1033477219 7:141702274-141702296 CCGCGGAGGCGCCTTTCCCACGG + Intergenic
1045047679 8:98294432-98294454 CCTCGGGGCCGCACTGCCCAAGG + Intergenic
1048303294 8:133266809-133266831 CCGGGGGGCTGCAGTTCCTCTGG + Intronic
1059389275 9:113988640-113988662 GCGCCAGGCCGCTTTTCCCCAGG - Intronic
1060296538 9:122347169-122347191 GCACGGGGCCGCGCTTCCCCCGG - Intergenic
1061693609 9:132354976-132354998 CTGCGGGCCCGCACTTCCGCTGG - Exonic
1061779985 9:132989716-132989738 CCCCGGGGCCTCATTTCCTCCGG + Intronic
1190109689 X:47582146-47582168 CTTAGAGGCCGCATTTCCCCCGG - Intronic
1199326173 X:146501338-146501360 CTTCAAGGCCGCATTTCCCCTGG + Intergenic