ID: 1115545460

View in Genome Browser
Species Human (GRCh38)
Location 14:34462044-34462066
Sequence CGCGGCCCGCGCCCCCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 493}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115545455_1115545460 -5 Left 1115545455 14:34462026-34462048 CCTGGGGAAATGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545450_1115545460 8 Left 1115545450 14:34462013-34462035 CCCAGGCCCGGGGCCTGGGGAAA 0: 1
1: 0
2: 5
3: 25
4: 319
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545437_1115545460 27 Left 1115545437 14:34461994-34462016 CCGCCGCTCCAGCCTCCACCCCA 0: 1
1: 2
2: 9
3: 171
4: 1278
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545453_1115545460 2 Left 1115545453 14:34462019-34462041 CCCGGGGCCTGGGGAAATGCGGC 0: 1
1: 0
2: 4
3: 26
4: 254
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545444_1115545460 15 Left 1115545444 14:34462006-34462028 CCTCCACCCCAGGCCCGGGGCCT 0: 1
1: 0
2: 13
3: 99
4: 896
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545451_1115545460 7 Left 1115545451 14:34462014-34462036 CCAGGCCCGGGGCCTGGGGAAAT 0: 1
1: 0
2: 2
3: 18
4: 248
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545454_1115545460 1 Left 1115545454 14:34462020-34462042 CCGGGGCCTGGGGAAATGCGGCC 0: 1
1: 0
2: 2
3: 21
4: 186
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545441_1115545460 19 Left 1115545441 14:34462002-34462024 CCAGCCTCCACCCCAGGCCCGGG 0: 1
1: 0
2: 4
3: 136
4: 1064
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545446_1115545460 12 Left 1115545446 14:34462009-34462031 CCACCCCAGGCCCGGGGCCTGGG 0: 1
1: 0
2: 6
3: 90
4: 835
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545439_1115545460 24 Left 1115545439 14:34461997-34462019 CCGCTCCAGCCTCCACCCCAGGC 0: 1
1: 0
2: 24
3: 143
4: 1248
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493
1115545449_1115545460 9 Left 1115545449 14:34462012-34462034 CCCCAGGCCCGGGGCCTGGGGAA 0: 1
1: 1
2: 4
3: 47
4: 375
Right 1115545460 14:34462044-34462066 CGCGGCCCGCGCCCCCAGCCCGG 0: 1
1: 0
2: 4
3: 60
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115545460 Original CRISPR CGCGGCCCGCGCCCCCAGCC CGG Intronic