ID: 1115545545 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:34462348-34462370 |
| Sequence | GCCGGGGCGCGCGCGGGTCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 313 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 18, 4: 290} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1115545545_1115545565 | 19 | Left | 1115545545 | 14:34462348-34462370 | CCCAGACCCGCGCGCGCCCCGGC | 0: 1 1: 0 2: 4 3: 18 4: 290 |
||
| Right | 1115545565 | 14:34462390-34462412 | CCGACCCGCGCTCATTGGCCAGG | 0: 1 1: 0 2: 0 3: 3 4: 38 |
||||
| 1115545545_1115545561 | 14 | Left | 1115545545 | 14:34462348-34462370 | CCCAGACCCGCGCGCGCCCCGGC | 0: 1 1: 0 2: 4 3: 18 4: 290 |
||
| Right | 1115545561 | 14:34462385-34462407 | CCCGCCCGACCCGCGCTCATTGG | 0: 1 1: 0 2: 0 3: 8 4: 41 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1115545545 | Original CRISPR | GCCGGGGCGCGCGCGGGTCT GGG (reversed) | Exonic | ||