ID: 1115545545

View in Genome Browser
Species Human (GRCh38)
Location 14:34462348-34462370
Sequence GCCGGGGCGCGCGCGGGTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115545545_1115545565 19 Left 1115545545 14:34462348-34462370 CCCAGACCCGCGCGCGCCCCGGC 0: 1
1: 0
2: 4
3: 18
4: 290
Right 1115545565 14:34462390-34462412 CCGACCCGCGCTCATTGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1115545545_1115545561 14 Left 1115545545 14:34462348-34462370 CCCAGACCCGCGCGCGCCCCGGC 0: 1
1: 0
2: 4
3: 18
4: 290
Right 1115545561 14:34462385-34462407 CCCGCCCGACCCGCGCTCATTGG 0: 1
1: 0
2: 0
3: 8
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115545545 Original CRISPR GCCGGGGCGCGCGCGGGTCT GGG (reversed) Exonic