ID: 1115546683

View in Genome Browser
Species Human (GRCh38)
Location 14:34470531-34470553
Sequence TGGGATTCCCCCTGCCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115546678_1115546683 18 Left 1115546678 14:34470490-34470512 CCTGTGTAGGAGACATGTGCACA No data
Right 1115546683 14:34470531-34470553 TGGGATTCCCCCTGCCTGCTAGG No data
1115546677_1115546683 19 Left 1115546677 14:34470489-34470511 CCCTGTGTAGGAGACATGTGCAC No data
Right 1115546683 14:34470531-34470553 TGGGATTCCCCCTGCCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115546683 Original CRISPR TGGGATTCCCCCTGCCTGCT AGG Intergenic
No off target data available for this crispr