ID: 1115549026

View in Genome Browser
Species Human (GRCh38)
Location 14:34488520-34488542
Sequence TTGTATTTTTAGAAAAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115549026_1115549031 -3 Left 1115549026 14:34488520-34488542 CCTCGCCTTTTCTAAAAATACAA No data
Right 1115549031 14:34488540-34488562 CAAAAATTGGCTTGGCGTGGTGG No data
1115549026_1115549034 25 Left 1115549026 14:34488520-34488542 CCTCGCCTTTTCTAAAAATACAA No data
Right 1115549034 14:34488568-34488590 ACCTATAATCCCAGTTACCCAGG 0: 4
1: 137
2: 4487
3: 52728
4: 186050
1115549026_1115549033 1 Left 1115549026 14:34488520-34488542 CCTCGCCTTTTCTAAAAATACAA No data
Right 1115549033 14:34488544-34488566 AATTGGCTTGGCGTGGTGGCGGG No data
1115549026_1115549032 0 Left 1115549026 14:34488520-34488542 CCTCGCCTTTTCTAAAAATACAA No data
Right 1115549032 14:34488543-34488565 AAATTGGCTTGGCGTGGTGGCGG No data
1115549026_1115549030 -6 Left 1115549026 14:34488520-34488542 CCTCGCCTTTTCTAAAAATACAA No data
Right 1115549030 14:34488537-34488559 ATACAAAAATTGGCTTGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115549026 Original CRISPR TTGTATTTTTAGAAAAGGCG AGG (reversed) Intergenic
No off target data available for this crispr