ID: 1115554471

View in Genome Browser
Species Human (GRCh38)
Location 14:34533496-34533518
Sequence AAGTTGCAACAGCTCCGACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115554471_1115554472 -8 Left 1115554471 14:34533496-34533518 CCTTGTCGGAGCTGTTGCAACTT 0: 1
1: 0
2: 1
3: 5
4: 55
Right 1115554472 14:34533511-34533533 TGCAACTTTTCCATTTCCTGAGG 0: 1
1: 0
2: 2
3: 25
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115554471 Original CRISPR AAGTTGCAACAGCTCCGACA AGG (reversed) Exonic
900394853 1:2449073-2449095 AAGCTGCTACAGCTCCGACCAGG - Intronic
910552594 1:88493457-88493479 CAGTTGCAACAGCTCAGCTAAGG + Intergenic
919757079 1:201073007-201073029 AACTTGCAAAAGCTCCCACGGGG + Intronic
922226869 1:223653021-223653043 AAGTTAAAACATCTCCAACAAGG + Intronic
924017657 1:239744812-239744834 AAGCTGCAGCAGCTCAGAGAGGG + Intronic
1069206002 10:65686262-65686284 AAGTTGCATCAGGCCAGACACGG - Intergenic
1074966792 10:118497918-118497940 AAGTGGCATCAGCTCTGATATGG + Intergenic
1075319714 10:121481083-121481105 AAGTTGCAACAGAGACCACAGGG + Intronic
1075562518 10:123478717-123478739 AAGATGCAACAGCGCAGACAAGG + Intergenic
1076215259 10:128688099-128688121 AATTTGCAAAAGCTCAGACTGGG + Intergenic
1078933932 11:15936017-15936039 AACTTGCACCAGCTGCTACAGGG + Intergenic
1080643103 11:34169511-34169533 AAGATGCTACAGCTCTTACATGG + Intronic
1087750730 11:102003873-102003895 AAATTGTAACAGCTTTGACATGG - Intergenic
1087777305 11:102268307-102268329 AAGCTTCAAAAGCTCCGACTTGG + Intergenic
1090428067 11:126623978-126624000 AAGATCCAACAGCTCAGACAAGG + Intronic
1101242385 12:102851325-102851347 AAGTTGCAACAGCCCTGAAAAGG + Intronic
1102077560 12:110072293-110072315 ATGTTACAACAGCTACAACATGG + Intronic
1102611850 12:114119323-114119345 AAGAAGCAACAGCACCCACAAGG + Intergenic
1103818929 12:123681551-123681573 AAGTGGTAACAGCTGCTACAAGG - Intronic
1104021135 12:124993427-124993449 AACTTGCAACAGCTTCAACCAGG - Intergenic
1106638201 13:31553696-31553718 GAGTTGCTGCAGCTCCAACAAGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1115554471 14:34533496-34533518 AAGTTGCAACAGCTCCGACAAGG - Exonic
1117274588 14:54180006-54180028 AAGTAGCAACAGTTCAGAGATGG + Intergenic
1121431304 14:93890285-93890307 AAATTGCAGCAGCACCGAGAGGG - Intergenic
1128419883 15:67481748-67481770 AAGTAGCAATAGCTACAACATGG - Intronic
1147190693 17:38736318-38736340 ATGTTGGAACAACTCTGACAGGG - Intronic
1147570911 17:41570342-41570364 AACTTCCAACAGCTGGGACATGG + Intronic
1149573419 17:57694106-57694128 TAGTTGCAACAGAGCCCACATGG + Intergenic
1149957458 17:61068621-61068643 AAGTGGCAAGAGATCCCACATGG - Intronic
1158530572 18:58256373-58256395 CAGTTGCAGCAGCCCCAACAAGG + Intronic
1158623020 18:59048757-59048779 AACTTGCAATAGCTCCCAAATGG - Intergenic
1164783564 19:30912353-30912375 AAGTTGCCACATTTCCCACATGG + Intergenic
1166160812 19:40951463-40951485 AACTTGCAACAACTCCCTCAGGG - Intergenic
1167807950 19:51802084-51802106 AAGTTGAAACAGCACCTTCAAGG + Intronic
934107717 2:88710997-88711019 AAGTTGTAATAGCTCCTCCAGGG - Intronic
935699077 2:105795099-105795121 AACTAGCAACATCCCCGACAGGG + Intronic
942832630 2:180254785-180254807 AAGTTCCAACAGTTCCTACCAGG - Intergenic
1173137199 20:40448696-40448718 CAGTTGCATCAGCTGCGAAATGG + Intergenic
1175433482 20:58925575-58925597 AAGTAGCAACAGCCCTGCCAAGG + Intergenic
1179051466 21:37892102-37892124 ATGTTTCAAAAGCTCCCACATGG - Intronic
1180226089 21:46393373-46393395 CAGATGCAACAGCACCGCCAGGG - Intronic
954704493 3:52471981-52472003 AAGCTGCAGCAGCTCAGTCATGG + Intronic
957966232 3:87324627-87324649 TAGTTGCACCAGCTCCATCAGGG + Intergenic
962051288 3:131818264-131818286 GAGTTGCAACAGCCCATACAGGG + Intronic
962684113 3:137830019-137830041 AAGATCCAACAGCTCCCACTAGG + Intergenic
966355219 3:179072108-179072130 AAGTTGCAAAAGCTCTGCCCAGG - Exonic
968632322 4:1658482-1658504 CACCTGCAACAGCTCAGACACGG + Intronic
973533241 4:51853818-51853840 AAGATGCAGCAGCTCCCCCATGG + Intronic
987308901 5:16664127-16664149 AAGTTGCAACAGAACGTACAGGG - Intronic
998226729 5:140332907-140332929 AAGTTGTAACAGTTCAGAAATGG + Exonic
1000942190 5:167375250-167375272 AAGCGGCTACTGCTCCGACATGG + Exonic
1010088809 6:71953822-71953844 GAGTTGCAACAGCTCTAATAAGG + Intronic
1023595633 7:41826899-41826921 AAGTTGCTACAGCCCTGACATGG + Intergenic
1028880993 7:95879976-95879998 ACCTTGGAACAGCTCCTACATGG - Intronic
1036023131 8:4871065-4871087 CAGTTGCAACAGCTCTGGCCTGG + Intronic
1041796988 8:61755690-61755712 AAGTCCTAACAGCTCAGACAAGG + Intergenic
1044959554 8:97516987-97517009 AAGTTGCAACAGATCCCACAAGG + Intergenic
1055612617 9:78038552-78038574 AAATTGCAAATGCTCCTACAAGG - Intergenic
1203779047 EBV:90652-90674 ATGTTTCAACCGCTCCGACTGGG - Intergenic
1193500290 X:82266138-82266160 AATTTGCAAAAGATCAGACATGG + Intergenic
1196343206 X:114621306-114621328 TAGTTGCAACAGAGCCTACATGG - Intronic