ID: 1115554851

View in Genome Browser
Species Human (GRCh38)
Location 14:34536934-34536956
Sequence GTTTTGTAGTATGTTAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115554850_1115554851 0 Left 1115554850 14:34536911-34536933 CCTGGTTGTGATACTGCACTATA 0: 1
1: 10
2: 87
3: 232
4: 595
Right 1115554851 14:34536934-34536956 GTTTTGTAGTATGTTAACACTGG 0: 1
1: 0
2: 1
3: 34
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115554851 Original CRISPR GTTTTGTAGTATGTTAACAC TGG Intronic
904529549 1:31159266-31159288 GTTTTGAAGTATGTTAAGTATGG + Intergenic
905021692 1:34819767-34819789 GTTTTGCAAGATGTTACCACTGG + Intronic
906384461 1:45355436-45355458 GTTTTGCAGTATATCAACTCCGG - Exonic
908327544 1:63038193-63038215 GTTTTGCAAAATGTTAAAACTGG + Intergenic
911744647 1:101427136-101427158 GTTTTCTAGTTTGTTTACATAGG + Intergenic
911852462 1:102836645-102836667 GTTATGTAAGATGTTAACATAGG + Intergenic
912789417 1:112637451-112637473 GTTTTGTTGTTTGTTGAGACAGG + Intronic
914882175 1:151555866-151555888 GTTTTGCAAGATGTTACCACTGG - Intronic
915241772 1:154527950-154527972 TTTTTGTAAGATGTTACCACTGG - Intronic
915383575 1:155467943-155467965 GTTATGTAAGATGTTAACATTGG - Intronic
917801435 1:178574117-178574139 GTTTTGTAAGATGTTACCATTGG - Intergenic
918855719 1:189754465-189754487 GTTGTGTAGTATGTTTATAGAGG + Intergenic
919836310 1:201576026-201576048 GTTTTGCAAGATGTTAACACTGG - Intergenic
923304779 1:232678435-232678457 GTTTAGTTTTCTGTTAACACGGG + Intergenic
923411386 1:233713420-233713442 TTTTTGGTGTTTGTTAACACAGG + Intergenic
923644284 1:235800338-235800360 GTTCTTGAGTATTTTAACACAGG - Exonic
923653054 1:235891803-235891825 GTTATGTAAGATGTCAACACTGG + Intergenic
923796458 1:237161448-237161470 TTTTTTTAGTTTGTTAACTCAGG + Intronic
923933873 1:238737677-238737699 GTTTTGCAAGATGTTACCACTGG - Intergenic
924846343 1:247776410-247776432 GTTTTGACTTATGTAAACACTGG + Intergenic
924930196 1:248724329-248724351 GTTTGGTATTAGGGTAACACTGG - Intronic
1063259709 10:4373122-4373144 ATTTTGTAAAATGTTAACAATGG - Intergenic
1063512417 10:6658739-6658761 GGTTTTTAGTATATTCACACAGG + Intergenic
1063967520 10:11358334-11358356 GTTTTGCAAGATGTTACCACTGG + Intergenic
1064223033 10:13457841-13457863 GTTTTCTACTATGTTAATAGTGG + Intronic
1064414538 10:15137040-15137062 GTTTTGCTGTATGTCAACACAGG + Intronic
1067056106 10:43051821-43051843 GTTTTGTAAGATGTTACCACTGG + Intergenic
1068428957 10:56907698-56907720 GTTTTGCAAGATGTTACCACAGG - Intergenic
1068746249 10:60533875-60533897 TCTTTGTAATATGGTAACACTGG + Intronic
1071776735 10:88797475-88797497 GGTTTGTAATATTTCAACACTGG + Intergenic
1074518177 10:114191239-114191261 GTTTTGCAGCATGTTAACATGGG - Intronic
1078240079 11:9523205-9523227 GTTTTGTACTTTGTTAAGGCAGG + Intronic
1079270458 11:18980419-18980441 TTTTTGTATTAGGTTGACACTGG + Intergenic
1079621251 11:22557547-22557569 GATTTACAGTATGTTAACAGAGG - Intergenic
1079817932 11:25085963-25085985 GTTTCATAGTATTTTAACATAGG + Intergenic
1079886541 11:25996845-25996867 GTTTTGTCTTATGTAACCACAGG - Intergenic
1085578650 11:77630379-77630401 GTTTTGAAGGATGTTAATAAAGG - Intronic
1091115742 11:133011492-133011514 GTTTTATAGCATGTCAACTCTGG - Intronic
1093374424 12:18407658-18407680 CTTTTGTTGTATGTTATCATAGG - Intronic
1095430137 12:42125242-42125264 GTTTTGTATCATGTTTACAACGG - Intronic
1096316076 12:50567237-50567259 GTTATGCAAGATGTTAACACTGG - Intronic
1096758058 12:53816634-53816656 CTTTTGTAGTCTGCTTACACTGG + Intergenic
1097137233 12:56868326-56868348 GTTTTGTAATATGTTTACTTGGG - Intergenic
1097602281 12:61707768-61707790 GTTTTGTAAAATGTTATCACTGG + Intergenic
1097605954 12:61754758-61754780 TATTTGTAGTATGTTCACCCAGG + Intronic
1098759540 12:74405638-74405660 TTTTCTTAGTATGTTACCACAGG - Intergenic
1099966294 12:89449301-89449323 GTTTAGTAGTATGTGAAAAATGG + Intronic
1100956919 12:99918768-99918790 GTTTTTTATTATTTTAATACAGG + Intronic
1101893539 12:108736508-108736530 GTTTTGCAAGATGTTACCACTGG - Intergenic
1103548974 12:121722574-121722596 TTTCTGCAGGATGTTAACACAGG - Intronic
1104181036 12:126381016-126381038 TTTTGGTATTATGGTAACACTGG - Intergenic
1104221251 12:126786931-126786953 GTTTTGTCCTCTGTTTACACAGG + Intergenic
1106089470 13:26576817-26576839 GTTACGTAGGATGTTACCACTGG - Intronic
1106724986 13:32474946-32474968 GTTATGTATAATATTAACACAGG - Intronic
1107134960 13:36933670-36933692 GTTTTGCAGGATGCTACCACTGG - Intergenic
1107366622 13:39685866-39685888 TTTCTGTAGTATGTCACCACAGG + Intronic
1107447535 13:40481982-40482004 GATTTGTAGTATGTTGTAACTGG - Intergenic
1107868110 13:44723323-44723345 GTTTTTTAGTATTTTAAGACAGG + Intergenic
1110386087 13:74912427-74912449 GTTTTGTAAAATGTCACCACTGG + Intergenic
1111045007 13:82803749-82803771 GTTGTGTAGTGTGTTTACATTGG + Intergenic
1115298848 14:31861102-31861124 GTTTTGCAAGATGTTACCACTGG + Exonic
1115554851 14:34536934-34536956 GTTTTGTAGTATGTTAACACTGG + Intronic
1117122794 14:52586479-52586501 GTTTTGCAGAATTTTAACAACGG + Intronic
1117357766 14:54942379-54942401 GTTTTGCAAAATGTTACCACTGG - Intronic
1118546659 14:66897142-66897164 GTTTTGTAAGATGTTACCACTGG - Intronic
1119073032 14:71606789-71606811 GTTATGTAAGATGTTAGCACTGG + Intronic
1119105807 14:71922519-71922541 GTTATGTAAGATGTTAACATAGG - Intergenic
1120634369 14:86932894-86932916 GTTATATAAGATGTTAACACAGG - Intergenic
1121956254 14:98216420-98216442 TTTTGGTAGCATGTTAATACAGG - Intergenic
1124064155 15:26323888-26323910 GTTTTATAGGATGGTAATACTGG - Intergenic
1124795899 15:32779225-32779247 GGTTTTTAGTATGTTCACAAGGG - Intronic
1124990011 15:34663503-34663525 GTTTTGTAAAATGTTATCATTGG + Intergenic
1126169248 15:45680747-45680769 CTTTTGTAGGATGTTAGCTCAGG + Intronic
1126471768 15:49020168-49020190 GTTTTGCAAGATGTTACCACAGG + Intronic
1128057858 15:64713982-64714004 GTTTTGTAGAATGCTACCACTGG + Intergenic
1128174659 15:65544479-65544501 GTTTTGTAGAATGCTACCATTGG + Intronic
1129137976 15:73571250-73571272 GTTTTGTTTTGTGTTAAGACAGG - Intronic
1131896382 15:97035103-97035125 GTTTTGCAAGATGTTACCACTGG + Intergenic
1132039345 15:98511960-98511982 GTTTTGTAGTAAGTTAGTCCTGG - Intronic
1133461062 16:5986443-5986465 GTTTTGCAAAATGTTGACACTGG - Intergenic
1133727645 16:8552599-8552621 GTTATGTAGGATGTCACCACTGG + Intergenic
1134030335 16:10987256-10987278 GTTTTGCAAGATGTTACCACTGG - Intronic
1134139481 16:11705241-11705263 GTTATGTAAGATGTTAACAATGG + Intronic
1134909485 16:18011535-18011557 GTTTTGCAAAATGTTACCACTGG - Intergenic
1138259630 16:55606222-55606244 GTTTTGCAAGATGTTACCACTGG + Intergenic
1138410810 16:56838564-56838586 TTTTTTTTGTATGTTAAGACAGG + Intronic
1138653851 16:58478615-58478637 GTTCTGTAGCATGATAACATTGG + Intronic
1141354367 16:83330309-83330331 GTTTTGTAAGATGTTTCCACTGG + Intronic
1142000577 16:87661981-87662003 GTTATTTAGTATGTTAATTCAGG + Intronic
1143604275 17:7972570-7972592 GTTTTGTAATATGTTACCACTGG + Intergenic
1146340808 17:32018369-32018391 GTTTTGAATTATGGTTACACTGG - Intronic
1147232038 17:39026776-39026798 GTTTTGAATTATGTTTACGCTGG - Intergenic
1147901355 17:43787504-43787526 GTTTTGCACTATGCTACCACTGG + Exonic
1148361277 17:47014446-47014468 GTTTTGAATTATGGTTACACTGG - Intronic
1148833690 17:50453651-50453673 GTTTTGCAAGATGTTAACATTGG + Intronic
1149797946 17:59538715-59538737 GTTATGTAACATGTTAACACTGG - Intergenic
1150599194 17:66635849-66635871 GTTATGTAAGATGTTATCACTGG + Intronic
1152996692 18:414106-414128 GTTTTGTAAGATGTTACCACTGG + Intronic
1153245413 18:3068328-3068350 GTTTTGTAAAATGTTACCACTGG - Intronic
1155031435 18:21988333-21988355 GTTTTGCAGGATGTTATCAGTGG + Intergenic
1155131597 18:22940268-22940290 GTTTTGTAGTCCATGAACACGGG + Intronic
1155140620 18:23041056-23041078 GTTTTGGAAGATGTTACCACTGG - Intergenic
1155407086 18:25500944-25500966 GTTTTTTAGTATGTTCACAGAGG - Intergenic
1156872144 18:41957718-41957740 GCTTTGTAGGATGTTCTCACTGG - Exonic
1157479374 18:48043704-48043726 GTTTTGCAAGATGTTACCACTGG + Intronic
1158115626 18:53992120-53992142 GTTTTGTAATATGTATACACTGG - Intergenic
1158450172 18:57557153-57557175 GTTGTGTAAGATGTTAACACTGG + Intronic
1159046774 18:63376203-63376225 ATTTTGCAGGATGTTACCACTGG + Intergenic
1159111978 18:64069961-64069983 GCTTTATACTATGTTAATACAGG + Intergenic
1159278796 18:66257153-66257175 ATTTTATTGTATGTTTACACAGG - Intergenic
1160249360 18:77187751-77187773 GTTTTGAAAAATGTTACCACTGG - Intergenic
1161564328 19:4991536-4991558 GTTATGTAAAATGTTACCACTGG - Intronic
1162265990 19:9574854-9574876 ATATTTAAGTATGTTAACACAGG + Intronic
1165635621 19:37337365-37337387 GTTTTGAAGGATGTTAAGAAGGG + Intronic
1168632342 19:57967336-57967358 GTTTTTTAACATGTGAACACTGG + Intronic
925726013 2:6872107-6872129 GTTTTGTAATATGTTTACTTAGG + Intronic
926417702 2:12666131-12666153 GTTTTGTAACATGTTACCACTGG - Intergenic
926463526 2:13163117-13163139 GTGTTGTATTATGTTCTCACAGG - Intergenic
929382109 2:41365388-41365410 GTTTTGTAGTACGGTGACAATGG - Intergenic
931127101 2:59290200-59290222 CATTTGCATTATGTTAACACTGG - Intergenic
931322897 2:61189226-61189248 ATGCTGTAGTATCTTAACACTGG - Exonic
931424680 2:62159877-62159899 GTTTTGAAGGATGTTACCATGGG + Intergenic
935022708 2:99246997-99247019 GTTTTGTTTTGTATTAACACAGG + Intronic
937110236 2:119361097-119361119 GTTTTGCAAGATGTTACCACTGG + Intronic
938874588 2:135519224-135519246 GTTTTCTAAGATGTTACCACTGG + Intronic
940119107 2:150242985-150243007 GTTTTGCAAAATGTTACCACTGG - Intergenic
941010158 2:160290489-160290511 TTTTTATAGTACTTTAACACAGG - Intronic
941438981 2:165509690-165509712 GTTATGTAAGAGGTTAACACTGG - Intronic
941503827 2:166314905-166314927 GGTTTTTAGTATGTTCACAAAGG - Intronic
941671546 2:168299124-168299146 GTTTTCTAGTGTTTTACCACAGG + Intergenic
942175138 2:173326054-173326076 GTTTTGCAAAATGTTACCACTGG - Intergenic
942888555 2:180959338-180959360 GTTTTTTAGAATGTTCTCACAGG + Intergenic
943647522 2:190423154-190423176 GTTTTGCAAGATGTTATCACTGG - Intronic
944051127 2:195471145-195471167 GTTTTGTAAGATGTTAACAGAGG - Intergenic
944388665 2:199193812-199193834 GTTTTTCACTATTTTAACACGGG + Intergenic
945853588 2:215040030-215040052 ACTTTTTAGTATGTTAACAATGG - Intronic
946668602 2:222077513-222077535 GGTTTATAGTCTGTGAACACGGG + Intergenic
947295079 2:228621817-228621839 GTTTTGCAAGATGTTACCACTGG + Intergenic
948500790 2:238392265-238392287 GTTCTGTAAGATGTTATCACTGG - Intronic
948664017 2:239523478-239523500 GTTTGGTAGGGTGTCAACACAGG - Intergenic
948683373 2:239653028-239653050 GTTTTGTAGGATGTTACCATGGG + Intergenic
1171542379 20:25973077-25973099 TTTTTGTAGTTTTTTATCACAGG + Intergenic
1173237302 20:41258297-41258319 GTTATGTAAGATGCTAACACTGG - Intronic
1173884033 20:46441065-46441087 GTTTTGCAAGATGTTACCACTGG - Intergenic
1174485755 20:50860178-50860200 GTTTTGAAGCATGTTACCACTGG - Intronic
1174682121 20:52418785-52418807 GTTTTGTTGTTTATGAACACTGG - Intergenic
1175086451 20:56463343-56463365 GTTTTGTACTTTGTTGACAAAGG - Intergenic
1175300053 20:57936397-57936419 GTTGTGTAGGATGTGACCACTGG - Intergenic
1175970060 20:62681281-62681303 GTTTTGTAGAATGTTACCATTGG - Intronic
1177124280 21:17176655-17176677 GTTTAGTATTATGGTAATACTGG - Intergenic
1178078137 21:29031855-29031877 ATTTTGTAAAATGTTACCACTGG - Intronic
1180058452 21:45372382-45372404 GTTATGTAATACATTAACACTGG + Intergenic
1180906764 22:19418819-19418841 GTTTTGCAAAATGTTAACATTGG + Intronic
1183030710 22:35102348-35102370 GTTTTGGAGTATTTTAAAGCAGG - Intergenic
950225578 3:11230880-11230902 GTTTTGTAATATGCTACCACTGG - Intronic
950450797 3:13064056-13064078 GTTTTGTAAGATGTTACCATTGG - Intronic
950472621 3:13195903-13195925 GTTTTGTAAAATGTTACCATTGG + Intergenic
950985681 3:17362874-17362896 GTTTTGCAGGATGTTACCATTGG - Intronic
952531301 3:34264818-34264840 GTTTTGTAAGATGTTTCCACAGG - Intergenic
952724100 3:36563922-36563944 GTTTTGCAAGATGTTACCACTGG - Intergenic
954237566 3:49268536-49268558 GTTATGTAAGATGTTAACATTGG - Intergenic
956192939 3:66624262-66624284 GTTTTGTAAAATGTTTCCACTGG - Intergenic
956546173 3:70406118-70406140 GTTTTGAAATATGTGTACACTGG - Intergenic
957360055 3:79143719-79143741 GTTTTGCAAGATGTTACCACTGG - Intronic
958078639 3:88716403-88716425 GTTTTGTATCATGGTAATACTGG - Intergenic
958606792 3:96368280-96368302 GTTTTGCAAAATGTTATCACTGG - Intergenic
958858484 3:99416578-99416600 GTTTTGTGAGATGTTAACATTGG + Intergenic
959594166 3:108111025-108111047 GTTCTGTAGCAGGGTAACACAGG + Intergenic
960013500 3:112859145-112859167 GTTTTGCAAAATGTTAGCACTGG + Intergenic
960251870 3:115464312-115464334 GTTTTGAAATATGTTAACATTGG + Intergenic
960821720 3:121740285-121740307 GTTTTGCAAAATGTTACCACTGG + Intronic
962044761 3:131744462-131744484 GCTTTGTAGGATGTTACCATCGG - Intronic
962260424 3:133898952-133898974 GTTATGTAAGATGTTATCACTGG - Intergenic
962510325 3:136092926-136092948 TTTTTGTAGTATGTGAACTAGGG - Intronic
963097104 3:141555312-141555334 GTTGTGTAAGATGTTAACACTGG + Intronic
963785138 3:149527027-149527049 GTTATGTAAGATGTTATCACTGG - Intronic
965421293 3:168462534-168462556 GTATAGTAGTATGATAACTCTGG + Intergenic
966789276 3:183650714-183650736 TTTTTGCAGTATGTTTATACTGG + Exonic
967401745 3:189070519-189070541 GTTTTGCAAAATGTTACCACTGG + Intronic
967491820 3:190100780-190100802 TTTTTGAAGTATGTAAATACAGG + Intronic
970212382 4:13723201-13723223 GTTTTGTAGGATATTATTACTGG - Intergenic
972483680 4:39522680-39522702 GATTGGTAGTTTATTAACACAGG - Intronic
972877586 4:43382721-43382743 GTTTTGTAGTATGTTATATTTGG + Intergenic
972881126 4:43424261-43424283 ATTATGTGGTCTGTTAACACTGG - Intergenic
972892818 4:43580235-43580257 GTTTTTTAGTCTATGAACACAGG + Intergenic
973285152 4:48407747-48407769 GTTTTTTAGTATATTCACAGAGG + Intronic
974412284 4:61556847-61556869 TTTTTACAGTGTGTTAACACAGG + Intronic
974558253 4:63480525-63480547 GTTTTATAAGATGTTACCACTGG + Intergenic
974754084 4:66181025-66181047 GTATTGTAGAATATTAACAGTGG + Intergenic
975044749 4:69787621-69787643 GTTTTGCAACATGTTACCACTGG - Intronic
976292784 4:83438351-83438373 ATTTTGTAGTATCTTAATATTGG - Intronic
976326110 4:83773533-83773555 GTTTTGTATTAGGTTAAGAAAGG + Intergenic
976665093 4:87582010-87582032 GTTTTGTGAGATGTTACCACTGG + Intergenic
977309869 4:95372743-95372765 GGTTGGTGGTTTGTTAACACAGG + Intronic
977598901 4:98914830-98914852 CTGTTGTAGGATGTTGACACTGG + Intronic
978749368 4:112230253-112230275 GTTTTGTAACATGTCACCACTGG - Intergenic
978794346 4:112694156-112694178 GCTTTGTAAAATGTTAACATGGG + Intergenic
979132693 4:117068259-117068281 TTTATGAAGTATCTTAACACAGG - Intergenic
980097158 4:128503231-128503253 GTAATGTAAAATGTTAACACTGG - Intergenic
980247136 4:130261445-130261467 GTTTTGTAAGATGTTATCATTGG - Intergenic
980459707 4:133092530-133092552 GTGTTGGAGTGTGTTCACACAGG + Intergenic
982054664 4:151536211-151536233 GTTTTGTAAACTGTTACCACTGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982561860 4:156937785-156937807 GTATTGTATTGTGTAAACACAGG - Intronic
982805929 4:159762411-159762433 GTTATGCAATATGTTACCACTGG - Intergenic
982990481 4:162267591-162267613 GTTTTGTATCAGGGTAACACAGG + Intergenic
984339873 4:178443330-178443352 GTTCTGCAGTTTGTTAAAACTGG + Intergenic
984860933 4:184237323-184237345 GTTATGTACGATGTTAACATTGG + Intergenic
987192743 5:15495943-15495965 GTTTTGCAAGATGTTACCACTGG - Intergenic
990254807 5:53956344-53956366 CTTTTGTAATATGGTAACCCTGG - Intronic
991105379 5:62836920-62836942 GTTTTGTAAGATGTTACCACTGG + Intergenic
994077413 5:95669140-95669162 GTTCTACAGAATGTTAACACTGG - Intronic
994930432 5:106176129-106176151 GATTTGTAGTAAGTTAAAATTGG + Intergenic
994947068 5:106409007-106409029 ACTTTGTAGTATTTTAACAAGGG - Intergenic
995159039 5:108953638-108953660 ATTTTGTAGTAAGTAAAAACTGG - Intronic
995510536 5:112904875-112904897 GTGTTCTAGTATATTAACATGGG - Intronic
995561441 5:113386223-113386245 CTTTGGTAGTATGTTGAGACAGG - Intronic
996167006 5:120236568-120236590 GTTTTGTAGTGTGGTGACAGTGG + Intergenic
997028646 5:130096519-130096541 GTTATGTAACATGTTAACAGAGG + Intronic
998748927 5:145295613-145295635 GTTTTGTAGAATTTTAAATCTGG + Intergenic
998864076 5:146477277-146477299 GTTTTTTACTATCTTAACATAGG + Intronic
999426858 5:151495423-151495445 GTTATGCAAGATGTTAACACTGG - Intergenic
1000315213 5:160083870-160083892 GAGTTGAAATATGTTAACACAGG + Intronic
1001355209 5:171014904-171014926 GTTTTGGAAGATGTTAACAATGG + Intronic
1002017024 5:176332795-176332817 GTTTTGTAATATATTACCATTGG - Intronic
1003403590 6:5810399-5810421 GTTTTGGATGAGGTTAACACTGG + Intergenic
1004901345 6:20197048-20197070 GTTATGTAAGATGATAACACTGG + Intronic
1008026609 6:46643995-46644017 GTTTTGCAAGATGTTAATACTGG - Intronic
1010437299 6:75848342-75848364 GTTTTGTAGTACCTTAAGGCAGG + Exonic
1012885346 6:104840093-104840115 GTTTTGCAAAATGTTACCACTGG + Intronic
1012945556 6:105461834-105461856 GTTTTGCAAGATGTTATCACTGG - Intergenic
1013278048 6:108605691-108605713 GTTTTGTTTTGTGTTAGCACAGG + Intronic
1013792394 6:113852455-113852477 TTTTTGTAGTATGTTGAGAGTGG - Intergenic
1014005746 6:116415938-116415960 GTTTTGTAGAAGTGTAACACAGG + Intronic
1015112833 6:129612727-129612749 ATATTGTAGTATGTGGACACTGG + Intronic
1016417207 6:143845330-143845352 GTTTTGTTGTATGTTGAGAAGGG + Intronic
1016787971 6:148034154-148034176 GTGTTGTAAGATGTTACCACTGG + Intergenic
1016903666 6:149128180-149128202 GTTTTATAGAATGTTAATATTGG + Intergenic
1018168167 6:161119776-161119798 GTCTTTCAGTCTGTTAACACAGG + Intergenic
1019566992 7:1688714-1688736 GTTTTGTAAGATGTTGCCACTGG - Intronic
1019931318 7:4225202-4225224 GTTTTGCAGGATGTTACCACTGG + Intronic
1020514451 7:9098617-9098639 GTTTTGTAAGATGTTATCATTGG - Intergenic
1020805784 7:12789053-12789075 GTTATGTAACATGTTAACACTGG + Intergenic
1022712890 7:32868580-32868602 TTTCTGTATTATGTTAACATTGG - Exonic
1023044752 7:36201355-36201377 GTTTTGTAGGAGGTTAACTTTGG + Intronic
1023935228 7:44734919-44734941 GCTTTGTAGTAAGTTAAAATTGG - Intergenic
1025934884 7:66027560-66027582 GTTATGTAAGATGTTAACATCGG + Intergenic
1026555297 7:71403282-71403304 GTTTTGCAAGATGTTACCACTGG - Intronic
1027786651 7:82588085-82588107 GTTCAGTATTATGTTAACGCTGG + Intergenic
1027903074 7:84143176-84143198 GTTTTGTAGAAAGTTTACTCTGG - Intronic
1028191151 7:87853904-87853926 GTTTTGTAAGATGGTACCACTGG + Intronic
1028843723 7:95456244-95456266 GTTTTGGAGAATATTATCACTGG - Intergenic
1029330738 7:99852410-99852432 GTTTTCTAATCTGTGAACACGGG + Intronic
1030001565 7:105069696-105069718 GTTATGCAAGATGTTAACACTGG - Intronic
1030465926 7:109903760-109903782 GTTTTGTATCAGGTTAACACTGG + Intergenic
1030476471 7:110039937-110039959 GTTTTGTATCAGGGTAACACTGG + Intergenic
1030919865 7:115369423-115369445 GTTTATTAGTATGTTAATACTGG - Intergenic
1031668075 7:124509993-124510015 GTTTTGAAATATGTATACACTGG - Intergenic
1036838804 8:12098908-12098930 GTCTTGTAGAATTTAAACACAGG - Intergenic
1036860592 8:12345151-12345173 GTCTTGTAGAATTTAAACACAGG - Intergenic
1037256354 8:16959815-16959837 GTATTATCGTATGTTAAGACTGG + Intergenic
1037443879 8:18945364-18945386 GTGTTGTAGTATCTTATCTCTGG - Intronic
1038700432 8:29844696-29844718 GTTTTGTATAATTTTAACAGAGG + Intergenic
1038974958 8:32685016-32685038 GTTTTGCAGAATGTTACCATTGG - Intronic
1039455980 8:37706967-37706989 GGTTTGTAGTCAGTTCACACAGG + Intergenic
1040283511 8:46086251-46086273 TTTTTGTAGTTTTTTATCACAGG - Intergenic
1040970298 8:53128673-53128695 TTTTAGTAGTCTGTGAACACAGG + Intergenic
1041189217 8:55336537-55336559 GTTATGTAGGATGTTATCACTGG + Intronic
1041643499 8:60228087-60228109 GTTTTGCAGTTAGTTAACATTGG - Intronic
1042538762 8:69886286-69886308 GTTTTGTAAGATGTTACCACTGG + Intergenic
1044664140 8:94618978-94619000 GTTTTGCAAAATGTTACCACTGG + Intergenic
1044793586 8:95872846-95872868 GTTTTATAGTATGGTGACAATGG - Intergenic
1044980505 8:97711557-97711579 GTTTTTTAACATGTTACCACTGG - Intronic
1046716767 8:117576538-117576560 GCTTTGTAGACTGTTAACAGAGG - Intergenic
1046793856 8:118349337-118349359 ATTTTGTAGTGTGTAGACACAGG + Intronic
1047065453 8:121277105-121277127 GTTTTATAGAATGTTACCATTGG - Intergenic
1049871259 8:144979385-144979407 CTTTTGTGGTATCTCAACACAGG - Intergenic
1051963052 9:22791348-22791370 GTTTTGCAAAATGTTAACACTGG + Intergenic
1053193767 9:36098501-36098523 TTCTTGTAGTATGTTACTACTGG + Intronic
1055558590 9:77500466-77500488 GCTTGGTAGTATGTTACCATTGG - Intronic
1055978902 9:81981389-81981411 ATTTTGTAAGATGTTACCACTGG - Intergenic
1057073598 9:92121905-92121927 GTTTTGCAAGATGTTAACACTGG - Intergenic
1057625511 9:96672975-96672997 GTTATGTAAAATGTGAACACTGG + Intergenic
1058414861 9:104776929-104776951 GTTATGTAATCTGTTAACAGTGG - Intronic
1058834124 9:108846038-108846060 GTTTTGCAAGATGTTACCACTGG - Intergenic
1059179936 9:112202050-112202072 GTTTTTGAGAATGTTAACAACGG - Intergenic
1059209276 9:112497128-112497150 ATTTTGCAATATGTTACCACTGG - Intronic
1060349105 9:122842043-122842065 GTTATGTAACATGTTACCACTGG + Intergenic
1203466825 Un_GL000220v1:95929-95951 GTTTTTTAGGATGATAAGACCGG - Intergenic
1187527783 X:20069714-20069736 GTTTTGTAGGATACTACCACTGG + Intronic
1187539431 X:20177242-20177264 GTTTTGTAAGATGTTACCATTGG - Intronic
1187909143 X:24094192-24094214 GTTTTGTAAGATGTTACCACTGG - Intergenic
1188217756 X:27500088-27500110 GTTTTGCAAGATGTTAACATTGG + Intergenic
1188334144 X:28907728-28907750 GTTTGGTACTAAGTTAATACTGG + Intronic
1188535363 X:31190767-31190789 GTTATGTAAGATGTTAACATTGG - Intronic
1189507011 X:41621925-41621947 GTTTTGTAAAATGTTACCAATGG - Intronic
1194595619 X:95853556-95853578 TTTTGGTAGTATGGTAATACTGG - Intergenic
1195583800 X:106538719-106538741 GTTTTGTATTATGGTAATCCTGG + Intergenic
1199035697 X:143048161-143048183 TTTTGGTAGTAGGGTAACACTGG + Intergenic
1199749937 X:150806121-150806143 GTTTTGCAGGATGTTACCACTGG + Intronic
1200678014 Y:6175171-6175193 GTTTTGGAGTATGTTTTCAGGGG - Intergenic
1200974211 Y:9191062-9191084 TGTTTATGGTATGTTAACACAGG - Intergenic
1202165192 Y:21980070-21980092 CTTTTGTAGTTTTTTAAAACTGG - Intergenic
1202226164 Y:22606304-22606326 CTTTTGTAGTTTTTTAAAACTGG + Intergenic
1202316951 Y:23589361-23589383 CTTTTGTAGTTTTTTAAAACTGG - Intergenic
1202553814 Y:26080697-26080719 CTTTTGTAGTTTTTTAAAACTGG + Intergenic