ID: 1115555093 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:34539381-34539403 |
Sequence | GATGGGGTCGCGCAGTCCCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 58 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 49} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1115555093_1115555104 | 19 | Left | 1115555093 | 14:34539381-34539403 | CCCCGGGACTGCGCGACCCCATC | 0: 1 1: 0 2: 0 3: 8 4: 49 |
||
Right | 1115555104 | 14:34539423-34539445 | GCACAAGTAACAGGCACGACAGG | 0: 1 1: 0 2: 0 3: 5 4: 167 |
||||
1115555093_1115555103 | 10 | Left | 1115555093 | 14:34539381-34539403 | CCCCGGGACTGCGCGACCCCATC | 0: 1 1: 0 2: 0 3: 8 4: 49 |
||
Right | 1115555103 | 14:34539414-34539436 | TTTGGCTTCGCACAAGTAACAGG | 0: 1 1: 0 2: 0 3: 4 4: 43 |
||||
1115555093_1115555097 | -8 | Left | 1115555093 | 14:34539381-34539403 | CCCCGGGACTGCGCGACCCCATC | 0: 1 1: 0 2: 0 3: 8 4: 49 |
||
Right | 1115555097 | 14:34539396-34539418 | ACCCCATCAGGAAAGCCCTTTGG | 0: 1 1: 0 2: 2 3: 15 4: 156 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1115555093 | Original CRISPR | GATGGGGTCGCGCAGTCCCG GGG (reversed) | Intronic | ||