ID: 1115555095

View in Genome Browser
Species Human (GRCh38)
Location 14:34539383-34539405
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115555095_1115555103 8 Left 1115555095 14:34539383-34539405 CCGGGACTGCGCGACCCCATCAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555095_1115555104 17 Left 1115555095 14:34539383-34539405 CCGGGACTGCGCGACCCCATCAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1115555104 14:34539423-34539445 GCACAAGTAACAGGCACGACAGG 0: 1
1: 0
2: 0
3: 5
4: 167
1115555095_1115555097 -10 Left 1115555095 14:34539383-34539405 CCGGGACTGCGCGACCCCATCAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115555095 Original CRISPR CTGATGGGGTCGCGCAGTCC CGG (reversed) Intronic