ID: 1115555097

View in Genome Browser
Species Human (GRCh38)
Location 14:34539396-34539418
Sequence ACCCCATCAGGAAAGCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 156}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115555090_1115555097 -3 Left 1115555090 14:34539376-34539398 CCTCCCCCCGGGACTGCGCGACC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156
1115555093_1115555097 -8 Left 1115555093 14:34539381-34539403 CCCCGGGACTGCGCGACCCCATC 0: 1
1: 0
2: 0
3: 8
4: 49
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156
1115555084_1115555097 25 Left 1115555084 14:34539348-34539370 CCTCTTCCTACAGGCGACATCGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156
1115555092_1115555097 -7 Left 1115555092 14:34539380-34539402 CCCCCGGGACTGCGCGACCCCAT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156
1115555086_1115555097 19 Left 1115555086 14:34539354-34539376 CCTACAGGCGACATCGGCACCGC 0: 1
1: 0
2: 0
3: 7
4: 22
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156
1115555095_1115555097 -10 Left 1115555095 14:34539383-34539405 CCGGGACTGCGCGACCCCATCAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156
1115555083_1115555097 26 Left 1115555083 14:34539347-34539369 CCCTCTTCCTACAGGCGACATCG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156
1115555091_1115555097 -6 Left 1115555091 14:34539379-34539401 CCCCCCGGGACTGCGCGACCCCA 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156
1115555094_1115555097 -9 Left 1115555094 14:34539382-34539404 CCCGGGACTGCGCGACCCCATCA 0: 1
1: 0
2: 2
3: 9
4: 75
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156
1115555089_1115555097 0 Left 1115555089 14:34539373-34539395 CCGCCTCCCCCCGGGACTGCGCG 0: 1
1: 0
2: 2
3: 216
4: 4775
Right 1115555097 14:34539396-34539418 ACCCCATCAGGAAAGCCCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115555097 Original CRISPR ACCCCATCAGGAAAGCCCTT TGG Intronic