ID: 1115555100

View in Genome Browser
Species Human (GRCh38)
Location 14:34539399-34539421
Sequence AAGCCAAAGGGCTTTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115555100_1115555106 18 Left 1115555100 14:34539399-34539421 CCATCAGGAAAGCCCTTTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 216
Right 1115555106 14:34539440-34539462 GACAGGCTCCCGAGCCGCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1115555100_1115555109 28 Left 1115555100 14:34539399-34539421 CCATCAGGAAAGCCCTTTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 216
Right 1115555109 14:34539450-34539472 CGAGCCGCTAGGGTCTGCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115555100_1115555105 17 Left 1115555100 14:34539399-34539421 CCATCAGGAAAGCCCTTTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 216
Right 1115555105 14:34539439-34539461 CGACAGGCTCCCGAGCCGCTAGG 0: 1
1: 0
2: 1
3: 94
4: 5612
1115555100_1115555103 -8 Left 1115555100 14:34539399-34539421 CCATCAGGAAAGCCCTTTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 216
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555100_1115555104 1 Left 1115555100 14:34539399-34539421 CCATCAGGAAAGCCCTTTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 216
Right 1115555104 14:34539423-34539445 GCACAAGTAACAGGCACGACAGG 0: 1
1: 0
2: 0
3: 5
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115555100 Original CRISPR AAGCCAAAGGGCTTTCCTGA TGG (reversed) Intronic