ID: 1115555103

View in Genome Browser
Species Human (GRCh38)
Location 14:34539414-34539436
Sequence TTTGGCTTCGCACAAGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115555090_1115555103 15 Left 1115555090 14:34539376-34539398 CCTCCCCCCGGGACTGCGCGACC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555092_1115555103 11 Left 1115555092 14:34539380-34539402 CCCCCGGGACTGCGCGACCCCAT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555099_1115555103 -7 Left 1115555099 14:34539398-34539420 CCCATCAGGAAAGCCCTTTGGCT 0: 1
1: 0
2: 4
3: 20
4: 165
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555094_1115555103 9 Left 1115555094 14:34539382-34539404 CCCGGGACTGCGCGACCCCATCA 0: 1
1: 0
2: 2
3: 9
4: 75
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555093_1115555103 10 Left 1115555093 14:34539381-34539403 CCCCGGGACTGCGCGACCCCATC 0: 1
1: 0
2: 0
3: 8
4: 49
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555095_1115555103 8 Left 1115555095 14:34539383-34539405 CCGGGACTGCGCGACCCCATCAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555098_1115555103 -6 Left 1115555098 14:34539397-34539419 CCCCATCAGGAAAGCCCTTTGGC 0: 1
1: 0
2: 0
3: 17
4: 153
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555089_1115555103 18 Left 1115555089 14:34539373-34539395 CCGCCTCCCCCCGGGACTGCGCG 0: 1
1: 0
2: 2
3: 216
4: 4775
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555100_1115555103 -8 Left 1115555100 14:34539399-34539421 CCATCAGGAAAGCCCTTTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 216
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1115555091_1115555103 12 Left 1115555091 14:34539379-34539401 CCCCCCGGGACTGCGCGACCCCA 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1115555103 14:34539414-34539436 TTTGGCTTCGCACAAGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115555103 Original CRISPR TTTGGCTTCGCACAAGTAAC AGG Intronic