ID: 1115555109

View in Genome Browser
Species Human (GRCh38)
Location 14:34539450-34539472
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115555100_1115555109 28 Left 1115555100 14:34539399-34539421 CCATCAGGAAAGCCCTTTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 216
Right 1115555109 14:34539450-34539472 CGAGCCGCTAGGGTCTGCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115555098_1115555109 30 Left 1115555098 14:34539397-34539419 CCCCATCAGGAAAGCCCTTTGGC 0: 1
1: 0
2: 0
3: 17
4: 153
Right 1115555109 14:34539450-34539472 CGAGCCGCTAGGGTCTGCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115555102_1115555109 15 Left 1115555102 14:34539412-34539434 CCTTTGGCTTCGCACAAGTAACA 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1115555109 14:34539450-34539472 CGAGCCGCTAGGGTCTGCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115555099_1115555109 29 Left 1115555099 14:34539398-34539420 CCCATCAGGAAAGCCCTTTGGCT 0: 1
1: 0
2: 4
3: 20
4: 165
Right 1115555109 14:34539450-34539472 CGAGCCGCTAGGGTCTGCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115555101_1115555109 16 Left 1115555101 14:34539411-34539433 CCCTTTGGCTTCGCACAAGTAAC 0: 1
1: 0
2: 2
3: 2
4: 71
Right 1115555109 14:34539450-34539472 CGAGCCGCTAGGGTCTGCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type