ID: 1115557449

View in Genome Browser
Species Human (GRCh38)
Location 14:34554652-34554674
Sequence CTGGGTAAATACAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115557439_1115557449 15 Left 1115557439 14:34554614-34554636 CCAGGCAAGATGATGTTGGCTCA No data
Right 1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG No data
1115557443_1115557449 -10 Left 1115557443 14:34554639-34554661 CCAGGTTAAACCACTGGGTAAAT No data
Right 1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG No data
1115557437_1115557449 20 Left 1115557437 14:34554609-34554631 CCAATCCAGGCAAGATGATGTTG No data
Right 1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115557449 Original CRISPR CTGGGTAAATACAAGGGGCA GGG Intergenic
No off target data available for this crispr