ID: 1115571465

View in Genome Browser
Species Human (GRCh38)
Location 14:34670667-34670689
Sequence CTTTAGGCCTGGAAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115571465_1115571473 16 Left 1115571465 14:34670667-34670689 CCATCATCCTTCCAGGCCTAAAG No data
Right 1115571473 14:34670706-34670728 CCTGATACTGCTGTGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115571465 Original CRISPR CTTTAGGCCTGGAAGGATGA TGG (reversed) Intergenic
No off target data available for this crispr