ID: 1115573500

View in Genome Browser
Species Human (GRCh38)
Location 14:34689164-34689186
Sequence GTATAATCCTTGGCCAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115573500_1115573504 8 Left 1115573500 14:34689164-34689186 CCATTATTGGCCAAGGATTATAC No data
Right 1115573504 14:34689195-34689217 CTATGTTCATTCATTCAATTGGG No data
1115573500_1115573503 7 Left 1115573500 14:34689164-34689186 CCATTATTGGCCAAGGATTATAC No data
Right 1115573503 14:34689194-34689216 CCTATGTTCATTCATTCAATTGG No data
1115573500_1115573505 9 Left 1115573500 14:34689164-34689186 CCATTATTGGCCAAGGATTATAC No data
Right 1115573505 14:34689196-34689218 TATGTTCATTCATTCAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115573500 Original CRISPR GTATAATCCTTGGCCAATAA TGG (reversed) Intergenic
No off target data available for this crispr