ID: 1115573504

View in Genome Browser
Species Human (GRCh38)
Location 14:34689195-34689217
Sequence CTATGTTCATTCATTCAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115573500_1115573504 8 Left 1115573500 14:34689164-34689186 CCATTATTGGCCAAGGATTATAC No data
Right 1115573504 14:34689195-34689217 CTATGTTCATTCATTCAATTGGG No data
1115573501_1115573504 -2 Left 1115573501 14:34689174-34689196 CCAAGGATTATACTATTTTACCT No data
Right 1115573504 14:34689195-34689217 CTATGTTCATTCATTCAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115573504 Original CRISPR CTATGTTCATTCATTCAATT GGG Intergenic
No off target data available for this crispr