ID: 1115574414

View in Genome Browser
Species Human (GRCh38)
Location 14:34696553-34696575
Sequence CAGAGATGTCACATATAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115574414_1115574420 16 Left 1115574414 14:34696553-34696575 CCCCATTATATGTGACATCTCTG No data
Right 1115574420 14:34696592-34696614 CTGCTTTGTAACATCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115574414 Original CRISPR CAGAGATGTCACATATAATG GGG (reversed) Intergenic
No off target data available for this crispr