ID: 1115581026

View in Genome Browser
Species Human (GRCh38)
Location 14:34758601-34758623
Sequence AAAACTAGACAGTGAGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115581024_1115581026 26 Left 1115581024 14:34758552-34758574 CCTGGGCGACAGAGTGAGACTGT 0: 667
1: 9196
2: 48601
3: 131500
4: 178816
Right 1115581026 14:34758601-34758623 AAAACTAGACAGTGAGTAACAGG 0: 1
1: 0
2: 2
3: 15
4: 248
1115581023_1115581026 30 Left 1115581023 14:34758548-34758570 CCAGCCTGGGCGACAGAGTGAGA 0: 15310
1: 100461
2: 170004
3: 197206
4: 179472
Right 1115581026 14:34758601-34758623 AAAACTAGACAGTGAGTAACAGG 0: 1
1: 0
2: 2
3: 15
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115581026 Original CRISPR AAAACTAGACAGTGAGTAAC AGG Intronic