ID: 1115581026

View in Genome Browser
Species Human (GRCh38)
Location 14:34758601-34758623
Sequence AAAACTAGACAGTGAGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115581023_1115581026 30 Left 1115581023 14:34758548-34758570 CCAGCCTGGGCGACAGAGTGAGA 0: 15310
1: 100461
2: 170004
3: 197206
4: 179472
Right 1115581026 14:34758601-34758623 AAAACTAGACAGTGAGTAACAGG 0: 1
1: 0
2: 2
3: 15
4: 248
1115581024_1115581026 26 Left 1115581024 14:34758552-34758574 CCTGGGCGACAGAGTGAGACTGT 0: 667
1: 9196
2: 48601
3: 131500
4: 178816
Right 1115581026 14:34758601-34758623 AAAACTAGACAGTGAGTAACAGG 0: 1
1: 0
2: 2
3: 15
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115581026 Original CRISPR AAAACTAGACAGTGAGTAAC AGG Intronic
900869741 1:5293487-5293509 AGTGCTAGACAGTGAGGAACCGG - Intergenic
901328687 1:8387099-8387121 AAAGCTAGACAGTGAAGCACTGG + Intronic
904236135 1:29118506-29118528 TAAAATAGACAGTGGGTATCGGG + Exonic
905515785 1:38560966-38560988 ACAGCTAGAGAGTGAGTGACGGG + Intergenic
907564548 1:55422662-55422684 AAAATAAAACAGTGGGTAACAGG - Intergenic
909171110 1:72297180-72297202 AAAACTTGACAGTGTGTCCCAGG - Intergenic
909630592 1:77766037-77766059 CAAATTAGAAAGTGAGTGACGGG - Intergenic
910601653 1:89039252-89039274 AAAACCAGATAGTGAGTAGAGGG + Intergenic
913467751 1:119159582-119159604 AACATTAGACAGTGAGGAAATGG - Intergenic
914280757 1:146169935-146169957 AAGACTACACATTGAGTAAATGG - Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
917278594 1:173357436-173357458 CAAACTAGAAAGTGAGAACCAGG + Intergenic
917646690 1:177035750-177035772 AGAACTAGACAGTGCAGAACTGG + Intronic
918424758 1:184397040-184397062 AAAACTAAACAGTGAGTTCTAGG + Intronic
918471734 1:184882277-184882299 AAAATAATACAATGAGTAACAGG + Intronic
919029969 1:192228756-192228778 AAAATTAAACAGTGAAAAACTGG + Intergenic
919030876 1:192240736-192240758 AGAATCAGACAGTGACTAACAGG - Intergenic
920384756 1:205563155-205563177 AAATGTAGACAGTATGTAACAGG - Intergenic
921360494 1:214327051-214327073 AAAAGCAGACAGTGAGCAGCAGG + Intronic
924627341 1:245706638-245706660 AAAACTTGCCAGTGAGAAAGAGG + Intronic
1063531990 10:6842199-6842221 AACACTGGACTGTGAGTACCAGG - Intergenic
1063575358 10:7257140-7257162 AAAACTGTACAGTGAGAAACAGG + Intronic
1063630540 10:7729808-7729830 AAAACTAGAAATTGAGTTACTGG + Intronic
1066653279 10:37679425-37679447 AAAAGTTGGCAGTGAGTAAAGGG + Intergenic
1067037635 10:42931964-42931986 AAAAGTTGGCAGTGAGTAAAGGG + Intergenic
1068286652 10:54946258-54946280 AAAACTTGAAAGTGAACAACCGG - Intronic
1068453596 10:57226260-57226282 CAAACTAGACAGAGAGTAAAAGG - Intergenic
1068847320 10:61692507-61692529 AGAAATAAACAGTGAGTAACAGG + Intronic
1069271824 10:66538139-66538161 AAGAGTAGCCAGTGAGGAACTGG - Intronic
1069342453 10:67427712-67427734 AAAACTAGACAGTGAGCTGGGGG + Intronic
1071423204 10:85522772-85522794 AGAACTAGACATTGACTATCAGG + Intergenic
1074967386 10:118503360-118503382 AAAACAAGACAGTGTGTACACGG - Intergenic
1076934176 10:133556415-133556437 GAAAATAGACAGTGAGTGTCAGG - Intronic
1078884723 11:15489026-15489048 AAGACTACACAGTGGGTAAGAGG + Intergenic
1079195545 11:18323209-18323231 AAAAATAGACCATGAGTACCTGG + Intronic
1079296485 11:19239708-19239730 AAAACTAGAAAGAGTGTAAAGGG - Intronic
1083081698 11:60100711-60100733 AACACTAAACAGTGCGTAAAAGG + Intergenic
1085511113 11:77088612-77088634 TGAACTAGACAGTGGGAAACAGG - Intronic
1088705897 11:112464554-112464576 AAAACTCCCCAGTGAGTAATGGG - Intergenic
1089662672 11:119995795-119995817 AAAACTAGGCAGAGAGTAGGGGG + Intergenic
1090276531 11:125423923-125423945 AAAACTACACAGCGATTAAAAGG + Intronic
1090344123 11:126053867-126053889 ACAACAACACAGTGAATAACAGG - Intronic
1090422166 11:126582949-126582971 AAAGCTACACAGTCAGTAAATGG + Intronic
1090761470 11:129840434-129840456 AAAACTGCACAGTGACTAACCGG - Intronic
1091245205 11:134087650-134087672 AAATCTAGTCACTCAGTAACTGG + Intronic
1092436692 12:8453202-8453224 TGAAATAGACATTGAGTAACAGG - Intergenic
1093059884 12:14590700-14590722 CAAACTAGAAAGTGATTAAAAGG - Intergenic
1094105030 12:26801776-26801798 AAAGTTATACAGTGAGTAACTGG - Intronic
1095861374 12:46921690-46921712 CAAGCTAGCCAGTTAGTAACAGG - Intergenic
1095911729 12:47433893-47433915 ATAACTATATAGTGAGAAACTGG + Intergenic
1097317606 12:58188781-58188803 GAAATTAGACTGTTAGTAACAGG - Intergenic
1106489217 13:30201911-30201933 AAAACTAGAGAGTCACTAAAAGG + Intergenic
1107430660 13:40337466-40337488 AAAAATAGAGATGGAGTAACTGG - Intergenic
1108290724 13:48957903-48957925 AACCATGGACAGTGAGTAACTGG + Intergenic
1109375904 13:61492575-61492597 AAAATTAAAGAATGAGTAACTGG + Intergenic
1111020280 13:82439345-82439367 AACAATAGACAGGGAGTAAATGG - Intergenic
1111618203 13:90689308-90689330 AAAATAAGACAGTCAGGAACTGG + Intergenic
1111654669 13:91137423-91137445 CAATCTAGAAAGTGAGTAAAAGG - Intergenic
1113725540 13:112597514-112597536 AAAACTAGAAAGAGATTTACAGG + Intergenic
1114057366 14:18983653-18983675 TAAACTTGAGAGTGAGTACCAGG + Intronic
1114105180 14:19418094-19418116 TAAACTTGAGAGTGAGTACCAGG - Intronic
1115416460 14:33140465-33140487 CACACTGGCCAGTGAGTAACGGG - Intronic
1115581026 14:34758601-34758623 AAAACTAGACAGTGAGTAACAGG + Intronic
1116419474 14:44716212-44716234 GAAACTAGGGAGTGAGTAATAGG - Intergenic
1118167617 14:63353280-63353302 AAAACTAGAAAGAGAGAAAGGGG + Intergenic
1120626000 14:86827161-86827183 AAAATTAGAAAGTGAGTCCCTGG + Intergenic
1122404438 14:101491562-101491584 CAGACTAGACAGTGAGTCACAGG + Intergenic
1202898693 14_GL000194v1_random:23891-23913 AAAACAAGCCACTGAGAAACGGG - Intergenic
1124114203 15:26825437-26825459 AAAATTAAACAGTGAATAGCTGG + Intronic
1125760017 15:42089841-42089863 CTGGCTAGACAGTGAGTAACTGG - Intronic
1126727085 15:51642948-51642970 AAGATTACACAGTGAGTAGCTGG - Intergenic
1126960148 15:53983698-53983720 AAAAGTAGAAAGAGAGTATCAGG - Intergenic
1126960864 15:53992591-53992613 AAAACAGGACTGTGAGTCACGGG - Intergenic
1128100474 15:64994781-64994803 AAAAAAAGACAGTGATTACCTGG + Intergenic
1130819656 15:87481148-87481170 TAAACTACACAGTGGCTAACAGG - Intergenic
1130891875 15:88140238-88140260 AAAACTAGAGATTGAGAAGCTGG + Intronic
1131497122 15:92922209-92922231 AAAACTAGAAATTGAGGAAGAGG - Intronic
1131523666 15:93135947-93135969 AAAATGAGACAGGGAGTAAGGGG - Intergenic
1132002234 15:98191975-98191997 AAAAATAGACAATGAATTACAGG + Intergenic
1132016725 15:98324436-98324458 AAAAGAAGACGGTGAGTAACAGG + Intergenic
1132306384 15:100817184-100817206 AAAACTAGCCTGTTAGGAACTGG + Intergenic
1133411245 16:5570903-5570925 GAAATAAGACAGTGAGTAAAAGG + Intergenic
1133782904 16:8953462-8953484 AAACCAAGACAGTAAGAAACGGG + Intronic
1133856306 16:9552322-9552344 AAAACAAAACAGAGAGCAACAGG - Intergenic
1138996503 16:62459752-62459774 AAAAATAAACAGTGAGAAAGGGG - Intergenic
1139168300 16:64597861-64597883 AAAACTAGATACTCAGAAACTGG + Intergenic
1143429740 17:6872274-6872296 AAAGCTAGGCAGTGAGTCAGTGG - Intergenic
1144733894 17:17544206-17544228 GCACCCAGACAGTGAGTAACTGG + Intronic
1145416994 17:22724135-22724157 AAAACTAGACAGAAAGTTTCTGG + Intergenic
1146666270 17:34706283-34706305 AAAACTAGAATGTCAGAAACTGG + Intergenic
1146705680 17:34999158-34999180 AAAATTACACAGTTAGTAAGAGG + Intronic
1147896323 17:43754013-43754035 AAAACTACACAGAAAGTAAGAGG + Exonic
1147985339 17:44303782-44303804 AAAAAAAGACAGAGAGAAACGGG - Intergenic
1148811372 17:50294350-50294372 AAAACTAGAAAATGAAAAACAGG + Intergenic
1150243299 17:63653404-63653426 AAAACTACACAGTGATGATCTGG - Intronic
1150503144 17:65670325-65670347 AAAAATATACAGAAAGTAACAGG - Intronic
1153167855 18:2282743-2282765 GAGACTAGACAGTGAGTACTGGG + Intergenic
1155398167 18:25408320-25408342 ATAAACAGACAGTGAGTAATGGG - Intergenic
1155563781 18:27110253-27110275 AATACTAGACAGTGTCAAACAGG - Intronic
1156223478 18:35078365-35078387 AAAACTATATAGTATGTAACCGG - Intronic
1156660883 18:39345174-39345196 AAAACTAGACAGAAAGAAATAGG + Intergenic
1158772335 18:60534473-60534495 AAATCTATAAAGTGAGTAAATGG - Intergenic
1159474082 18:68895788-68895810 AGAATTAGACAATGAGTAAATGG + Intronic
1159607729 18:70493079-70493101 AAAACTATCCAGAGAGTAAAAGG - Intergenic
925250354 2:2430182-2430204 AAGACTAGACAGTGATAAAATGG - Intergenic
925335601 2:3097057-3097079 AAACCTAGACGGTGAATCACTGG + Intergenic
926363703 2:12113883-12113905 AAAACTAGACTCTGAGGAAATGG - Intergenic
927030296 2:19114430-19114452 AAACTCAAACAGTGAGTAACAGG - Intergenic
927685398 2:25167517-25167539 GAAACTAGACAGTGCGTTTCAGG + Intronic
930071930 2:47372784-47372806 AAAAAAAGGCAGTGACTAACAGG + Intronic
932977973 2:76627021-76627043 AAAACTATACGGTGACAAACTGG - Intergenic
933133837 2:78706597-78706619 AAAACTAGGCAGTGGTTAAGTGG + Intergenic
933273099 2:80254845-80254867 AAGATCACACAGTGAGTAACTGG + Intronic
934015090 2:87871961-87871983 AAGGCTAGACAGAGAGCAACTGG + Intergenic
934579023 2:95423549-95423571 AAAACTAGACAGTGGTTATGAGG - Intergenic
934600424 2:95653154-95653176 AAAACTAGACAGTGGTTATGAGG + Intergenic
936533786 2:113295217-113295239 AAAACTAGACAGTGGTTATGAGG + Intergenic
936849424 2:116877645-116877667 AAATCTAGACAGTGGCTAAATGG + Intergenic
937671491 2:124542211-124542233 AAAAATAGATAGGGAGGAACAGG - Intronic
938283781 2:130089870-130089892 TAAACTTGAGAGTGAGTACCAGG - Intronic
938284930 2:130104387-130104409 TAAACTTGAGAGTGAGTACCAGG - Intronic
938323740 2:130383293-130383315 AAAACTAGAAAGTGAGGGAGAGG + Intergenic
938334429 2:130478436-130478458 TAAACTTGAGAGTGAGTACCAGG - Intronic
938335573 2:130492934-130492956 TAAACTTGAGAGTGAGTACCAGG - Intronic
938354250 2:130627729-130627751 TAAACTTGAGAGTGAGTACCAGG + Intronic
938355395 2:130642232-130642254 TAAACTTGAGAGTGAGTACCAGG + Intronic
938430674 2:131234503-131234525 TAAACTTGAGAGTGAGTACCAGG + Intronic
938431826 2:131249023-131249045 TAAACTTGAGAGTGAGTACCAGG + Intronic
939610480 2:144303655-144303677 AATACTAAAAAGGGAGTAACAGG + Intronic
939703611 2:145424178-145424200 TAAACTAGACAGTGATAAATGGG + Intergenic
940963601 2:159813314-159813336 AAAACAAAACAGAGAATAACAGG - Intronic
942012659 2:171778225-171778247 AAAAAAAGACAGTGAGCAAACGG + Intergenic
943247922 2:185479075-185479097 ATAATTAGAGAGTGAGTAGCTGG + Intergenic
943989440 2:194668788-194668810 AAACCTAAACAATGAATAACTGG + Intergenic
945159108 2:206870793-206870815 AAAACTAGGCAGTGTGGAAATGG - Intergenic
945275551 2:207984106-207984128 AAAACTGAACAATGAGTACCTGG - Intronic
945677264 2:212870296-212870318 AAAGCTAATCAGTGAGTATCTGG - Intergenic
945714469 2:213340583-213340605 AAGAGTAGACAGTGAGGAAGTGG + Intronic
947911791 2:233805692-233805714 TAAACAAGACAGTGAGATACTGG + Intronic
948428972 2:237906508-237906530 TAATCTAGAAAGTGAGTAAATGG - Intronic
948967089 2:241391271-241391293 AAAACAAGCCAGTTAGTAGCAGG + Intronic
1168751745 20:286999-287021 AAAACTATACAGCGATAAACAGG - Intronic
1173215149 20:41074546-41074568 AAATCTAGCCAGGGAGAAACAGG - Intronic
1175317795 20:58063441-58063463 AAAGCTAGAAAGAGAGTATCTGG + Intergenic
1176134007 20:63511707-63511729 AAAACAAGACAGTGAGGGCCGGG - Intergenic
1176911607 21:14571869-14571891 AAATGTATACAGTGAGCAACGGG - Intronic
1178702579 21:34845849-34845871 AAAACAAGGCAGAGAATAACTGG - Intronic
1180475855 22:15706262-15706284 TAAACTTGAGAGTGAGTACCAGG + Intronic
1181986823 22:26805639-26805661 AAAGCTACACAGAAAGTAACAGG - Intergenic
1184368077 22:44065138-44065160 AAAACTAGTCAGTGAGCACTGGG - Intronic
951537171 3:23750754-23750776 CAAACAAAAAAGTGAGTAACTGG + Intergenic
952021579 3:29028326-29028348 AAAACTAGTCAGTTAGAAAAAGG - Intergenic
952040905 3:29260719-29260741 AAAACTAGAAAATGAATAAAAGG - Intergenic
952135054 3:30409580-30409602 AAAAGGAGACAGTGAGAAAAAGG - Intergenic
952243017 3:31553126-31553148 AAAACTTGATAGGGAGGAACTGG + Intronic
953423847 3:42776392-42776414 AAAACTCGACAGTTAGAAATTGG - Intronic
956994874 3:74814547-74814569 TCAACTAGATAGTAAGTAACTGG - Intergenic
958087049 3:88823635-88823657 TGAACTAAACAATGAGTAACTGG - Intergenic
958576382 3:95953911-95953933 AAAACTAGGCAGTGAAACACCGG + Intergenic
958787128 3:98610016-98610038 GGAACTAGACACTGAGTAAAAGG - Intergenic
958914218 3:100030320-100030342 AAAACTAGACAGTGGCTCCCTGG + Intronic
959527417 3:107392754-107392776 ATAACTAGCCAGAAAGTAACTGG - Intergenic
960879484 3:122330195-122330217 AAAACTAGCAAGTAAGTGACAGG - Intronic
961291402 3:125849570-125849592 AAAACTAGAGAGGGAGAAAGGGG + Intergenic
962420104 3:135220385-135220407 AAAGCTAGAGAGTAAGAAACAGG + Intronic
962560394 3:136600441-136600463 AAAACTACAAAGTGATGAACAGG - Intronic
963633359 3:147761904-147761926 AAACGTAGACAATGAGTATCTGG - Intergenic
963999547 3:151753521-151753543 ACAACTAGCCAATGAGTATCTGG - Intronic
964361599 3:155903676-155903698 ATAACTATACAGTTATTAACAGG - Intronic
965828384 3:172753415-172753437 AAAGCTAGACAGGGAATAAAAGG - Intronic
967968815 3:194984624-194984646 AAAGCCAGACAGTCTGTAACTGG + Intergenic
969146267 4:5126499-5126521 AGCACTAGACAGTGAGACACTGG - Intronic
969290849 4:6239110-6239132 ACAACGACACAGTGAGGAACTGG - Intergenic
972327353 4:38029243-38029265 AAAACAAGACAGCTAGCAACTGG + Intronic
972673816 4:41240114-41240136 AAAACTTGCCAGTGTCTAACCGG - Intergenic
972868687 4:43268678-43268700 AAAAATAAACAATGAGGAACAGG - Intergenic
972871121 4:43299634-43299656 ATAACTAGAAAGTGAATGACTGG + Intergenic
974509905 4:62825595-62825617 AAAACTAGACAGTATCTATCTGG + Intergenic
974674092 4:65068951-65068973 AAAACTGGATAGTGAGCAAGTGG - Intergenic
975399414 4:73917363-73917385 AACACCAGACAGTGAGTCAGAGG + Intergenic
975516005 4:75249089-75249111 CAAAGTTGACTGTGAGTAACTGG - Intergenic
975540551 4:75505914-75505936 GAAACTAAACAGAGAGCAACAGG + Intronic
976915627 4:90371072-90371094 AAAACTAGACAGTTATTTATAGG - Intronic
978890559 4:113821562-113821584 ATAACTAGAAAGTGAATAAAGGG + Intergenic
978992343 4:115100111-115100133 AAAACTATAGAGTGAGTGAAAGG + Intronic
979673943 4:123390258-123390280 GAAAGAGGACAGTGAGTAACAGG - Intergenic
980499147 4:133626339-133626361 AAAACTAGAAAATGTGTGACAGG - Intergenic
982253387 4:153429848-153429870 AAAAAAAGAGGGTGAGTAACTGG - Intergenic
982936204 4:161479791-161479813 ATAAATTGACAGTGAATAACTGG - Intronic
983528792 4:168788423-168788445 AAAACTATAGAGTCAGTAAAAGG + Intronic
983924765 4:173388464-173388486 AAAAATAGACAGTGATTTCCAGG + Intronic
984815102 4:183828869-183828891 AAAACTAGACAGAGAATCATGGG + Intergenic
985661097 5:1156829-1156851 ACATCTAGACAGTGACTTACAGG + Intergenic
986741140 5:10706403-10706425 AAGGCTACACAGTGAGTAAGAGG + Intronic
987209950 5:15670887-15670909 AGAACTAGATAGTGAGGAAAGGG - Intronic
987313056 5:16699112-16699134 AAAACGAGACAGGGAGAGACAGG + Intronic
987438358 5:17925552-17925574 GAAACTAGAAAATGTGTAACAGG - Intergenic
988062322 5:26187019-26187041 AAACATAGACAGTGAGAAACAGG + Intergenic
988077430 5:26370477-26370499 AAAGCTGGAAAGTGGGTAACTGG - Intergenic
990746364 5:58963229-58963251 AATAGTAGACAGTGAGACACAGG - Intergenic
990963758 5:61422414-61422436 AAAAATAGACACTTAGTAAGTGG - Intronic
991481182 5:67081919-67081941 ATAACTTGACAGTGAGGAACTGG + Intronic
992871563 5:81010878-81010900 AAAAATATACAATGAGTTACTGG - Intronic
993408560 5:87545053-87545075 AAAATAAGAGAGTGAGTCACTGG - Intergenic
994747607 5:103698112-103698134 AAAAGTGGACAATGTGTAACAGG - Intergenic
995252560 5:110010608-110010630 AATAATAGACACTGAGTAATTGG - Intergenic
996372902 5:122772144-122772166 AAAACAAGAGTGTGAATAACAGG - Intergenic
997098526 5:130941526-130941548 AAAACTAGAAAGTGATTAAGTGG - Intergenic
998754845 5:145365906-145365928 CAAAGTAGAAAGTGAGTAAGTGG + Intergenic
998769443 5:145525188-145525210 AACATCAGACAGTGAGTGACAGG + Intronic
999515733 5:152299862-152299884 AAAACAGGACAGTGAGTAGTAGG - Intergenic
1000726048 5:164772393-164772415 AAAATTAGTAACTGAGTAACTGG + Intergenic
1001999315 5:176188671-176188693 ACCACCAGACACTGAGTAACTGG - Intergenic
1002137456 5:177116761-177116783 AAAACGAGACAGAGAACAACTGG - Intergenic
1005391341 6:25336622-25336644 AATACTAGATTGTGAGCAACAGG - Intronic
1005694269 6:28336405-28336427 AAACGTAGAGAGCGAGTAACAGG + Intronic
1009318011 6:62247609-62247631 AAGACAACACAGTGAGTAAGTGG - Intronic
1009553507 6:65131227-65131249 AAAACTATAAAGTAAGTAAGGGG + Intronic
1009943076 6:70312178-70312200 AGAAAGAGACACTGAGTAACTGG + Intergenic
1010790336 6:80056677-80056699 AAAATTACACAGTGTGTAACAGG - Intergenic
1011736897 6:90319867-90319889 ATAACTAGACACTGTGTAATTGG - Intergenic
1012545833 6:100418603-100418625 AAGACTAGACAGTGAGGATTTGG + Intronic
1012686208 6:102253074-102253096 AAGACTAAACAGAGAGTAAAAGG - Intergenic
1013878404 6:114863174-114863196 AAAACTAGAAAGTGATTGAGTGG + Intergenic
1013985887 6:116193205-116193227 AAAAATAAACAGTGAAAAACTGG - Intronic
1015835664 6:137417534-137417556 AAAACTACACAGTTAGTAAGTGG + Intergenic
1021378582 7:19938782-19938804 AAAAACAGACTGTGAGGAACAGG + Intergenic
1023331564 7:39123014-39123036 CAAACCACACAGTGTGTAACTGG - Intronic
1023376098 7:39557136-39557158 AAGACTACACAGTCAGTAAGTGG + Intergenic
1025474453 7:60902226-60902248 AATGCTAGACAGCGAGTTACTGG - Intergenic
1025512550 7:61587648-61587670 AATGCTAGACAGCGAGTTACTGG + Intergenic
1028861502 7:95657002-95657024 AAAATTAGACTGTGAGTTGCTGG - Intergenic
1029165096 7:98582940-98582962 AAAAAAAGACAGACAGTAACAGG + Intergenic
1030920338 7:115376744-115376766 AAAACTAGACTGGGAATAAATGG + Intergenic
1031166009 7:118227852-118227874 AAAACTATACAGTTAGGAAAAGG + Intronic
1036554446 8:9846261-9846283 AAATCAAGACAGTGTGGAACGGG + Intergenic
1038585157 8:28781730-28781752 AAAACTATACAGATAGTAAAAGG + Intronic
1039352799 8:36781028-36781050 AATACTAGACACAGAGTAATCGG + Intergenic
1040643859 8:49375345-49375367 AAAACAAGACAGTGTGGTACTGG + Intergenic
1042617223 8:70663271-70663293 AAAATTAAACAGTGAGTAACTGG + Exonic
1043615548 8:82120564-82120586 AAAACTGGACACTTAGTCACTGG + Intergenic
1043841896 8:85116094-85116116 AAAACTAGAGATTCAGTAGCAGG - Intronic
1046334310 8:112764365-112764387 AAAAATAAACAGTGAGTTTCAGG + Intronic
1046720728 8:117615906-117615928 AAAACTACACAGAGAGAAAGGGG - Intergenic
1046939358 8:119916117-119916139 AAAGTTACACAGTGAATAACGGG + Intronic
1049414967 8:142490960-142490982 AGAGCCAGACAGTGAGTGACAGG - Intronic
1050243853 9:3667208-3667230 AAAACTACATATTGGGTAACTGG + Intergenic
1050715194 9:8516530-8516552 AAAACAAGTCAGTGATTCACAGG + Intronic
1052493291 9:29193708-29193730 GAAACAACACAGTGAGTGACAGG - Intergenic
1053322077 9:37107677-37107699 AAGACTTAACAGTGAGTAAATGG - Intergenic
1057443112 9:95096269-95096291 AAACCTAGGCAGTGAGTAGCGGG + Intergenic
1058593675 9:106592011-106592033 AAAGGTAGACAGTGAGTAACAGG - Intergenic
1058611698 9:106784106-106784128 AAAGCCAGACAGGGAGTAAGTGG + Intergenic
1058631553 9:106993536-106993558 AAAAACAGACAGGGAGTCACAGG - Intronic
1059074487 9:111177633-111177655 AAAACTGGAAAATGAGTAAAAGG - Intergenic
1060999585 9:127895666-127895688 GAAACTACACAGTGATTAAACGG - Intronic
1189999798 X:46674975-46674997 AAAACTTGCCAGTGAGGAATGGG - Intronic
1192539865 X:71958586-71958608 AAAACTACACAGTGGGGAATTGG + Intergenic
1193209369 X:78787701-78787723 AAAATGAGACAGTGATCAACAGG + Intergenic
1193946241 X:87739162-87739184 AAAAAAAAACAGTGAGAAACAGG - Intergenic
1197939289 X:131772758-131772780 CAAAAAAGACAGAGAGTAACAGG - Intergenic
1198115510 X:133541043-133541065 AAAACTATTCTGTGAGCAACAGG + Intronic
1199129387 X:144166548-144166570 AAGGCTAGACAGAGAGCAACTGG - Intergenic
1201778887 Y:17696535-17696557 AAAACTAGAAAGTAGGTATCTGG - Intergenic
1201822669 Y:18209457-18209479 AAAACTAGAAAGTAGGTATCTGG + Intergenic
1201975596 Y:19845335-19845357 AAAATTAGCCAGTGAGAAATAGG - Intergenic