ID: 1115582813

View in Genome Browser
Species Human (GRCh38)
Location 14:34778220-34778242
Sequence CTAGCTAGGTGGAAATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115582813_1115582819 6 Left 1115582813 14:34778220-34778242 CCTTCCCATTTCCACCTAGCTAG 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1115582819 14:34778249-34778271 GACATGGTGATAAATCATTTTGG 0: 1
1: 0
2: 0
3: 17
4: 199
1115582813_1115582820 19 Left 1115582813 14:34778220-34778242 CCTTCCCATTTCCACCTAGCTAG 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1115582820 14:34778262-34778284 ATCATTTTGGAACATGAGAATGG 0: 1
1: 0
2: 2
3: 41
4: 317
1115582813_1115582817 -10 Left 1115582813 14:34778220-34778242 CCTTCCCATTTCCACCTAGCTAG 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1115582817 14:34778233-34778255 ACCTAGCTAGAATGCAGACATGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115582813 Original CRISPR CTAGCTAGGTGGAAATGGGA AGG (reversed) Intronic
902174466 1:14638863-14638885 TTAGCTGGGTGGAAATGGGTGGG - Intronic
902180992 1:14688212-14688234 CTAGCTAGCTGGCCATGGAAGGG + Intronic
902405620 1:16181913-16181935 CTAGCTGGTGGGCAATGGGAGGG + Intergenic
902579433 1:17398952-17398974 GTACCTATGAGGAAATGGGAGGG + Intronic
903402480 1:23065557-23065579 TTAACTAGGTGGAAATGGATGGG + Intronic
904106241 1:28087324-28087346 CTACAAAGGTGGAAATGGTAAGG + Intronic
907552626 1:55317293-55317315 CTAGCTATGTGGTCTTGGGAGGG - Intergenic
909001718 1:70225506-70225528 CTATTAAGGTGGAAATTGGAAGG + Intronic
909551737 1:76905459-76905481 ATAGACAGGTGCAAATGGGAAGG + Intronic
910000365 1:82333808-82333830 CTACCTAGCTGTAAATGGCAAGG + Intergenic
910601664 1:89039309-89039331 CTAGCAAGGTAGAAGTGGGCTGG + Intergenic
911386180 1:97178235-97178257 CTAGCTACTTGCAGATGGGAAGG + Intronic
912567096 1:110595523-110595545 CTACCTAGATGGGAGTGGGAGGG - Intronic
914948440 1:152087902-152087924 TTAGCTAGGTGTAAAATGGATGG + Intronic
915827710 1:159096270-159096292 CTAGCTAGTTGGCCTTGGGAGGG + Intronic
916193225 1:162198926-162198948 CTAGCTAGGTGGAAAGCAGCTGG + Intronic
916330397 1:163609960-163609982 ATGGAGAGGTGGAAATGGGATGG + Intergenic
917840107 1:178970504-178970526 CCAGCTAGGTGGAAACAGAAGGG + Intergenic
919065129 1:192684500-192684522 CTAGCTTGATGGCAATGGCATGG + Intergenic
920162904 1:204013297-204013319 ACAGCTAGGTGGAAGTGGTAAGG + Intergenic
920368036 1:205458344-205458366 ATAGCTGGGTGAAGATGGGATGG + Intergenic
923357804 1:233177704-233177726 CTAGGCAGGTGGACATGAGAAGG - Intronic
1068743160 10:60498096-60498118 GCAGCGAGGTAGAAATGGGAAGG - Intronic
1071949691 10:90688461-90688483 GTATCTATGTGGAAATGTGAGGG - Intergenic
1072431636 10:95377517-95377539 CAAGCTAGGTTGAAATCGGAGGG + Intronic
1072539378 10:96386591-96386613 CAAGCCAGGTAGAAATAGGATGG + Intronic
1076122145 10:127944813-127944835 TTAGGTAGGTGGCAATGAGATGG + Intronic
1077176549 11:1193708-1193730 CCACCCAGGTGGAAATGGGCGGG + Intronic
1080976348 11:37345254-37345276 CTAGCTGTGTGGAATTGAGAAGG + Intergenic
1081543748 11:44054963-44054985 CTAGCTTGGGGGTAATGGGAAGG - Intronic
1082840904 11:57689206-57689228 ATAGCTAAGTGAAAATGGAATGG - Intronic
1085301884 11:75463432-75463454 CCAGCCAGGTGGAAGTGGGGTGG + Intronic
1086571893 11:88294646-88294668 TTAGCTAGTTGGAAAATGGATGG - Intronic
1088334852 11:108692492-108692514 CTGGCTTTGTGGGAATGGGACGG + Intronic
1088397480 11:109384476-109384498 GTAGGTAGCTGGAAATGGCAAGG - Intergenic
1088543508 11:110937347-110937369 CCAGCTGGGAGGAAATGGGCAGG - Intergenic
1090236660 11:125153272-125153294 CCGTCTAGGTGGAAATGGCATGG - Intergenic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1094339141 12:29390876-29390898 CTGGGTTGATGGAAATGGGAAGG + Intergenic
1094418454 12:30243082-30243104 ATATGTAGTTGGAAATGGGAGGG - Intergenic
1100880515 12:99010858-99010880 CTAGCTACTTGAAAGTGGGAGGG - Intronic
1100977443 12:100137220-100137242 CTATCTAGGTGGAAAAGTAATGG - Intronic
1104011539 12:124934040-124934062 TTAGCTAGGTGGAAATTAGATGG - Intergenic
1104598666 12:130137708-130137730 ATAGCCAGGTGGAAAGGGGGAGG + Intergenic
1106300350 13:28458744-28458766 CCAGCTACGTGGAAATTGGATGG - Intronic
1110078939 13:71286746-71286768 CTAGCTATGTGGCTATGGGAAGG - Intergenic
1110524847 13:76524368-76524390 ATTGCTACATGGAAATGGGAGGG - Intergenic
1110902662 13:80842859-80842881 TGAGGTAGGTGGAAATGAGAAGG - Intergenic
1112566798 13:100558825-100558847 GTAGCTAGGGGGAGAGGGGATGG + Intronic
1114301975 14:21386317-21386339 CTTGATTGGTGGTAATGGGAAGG + Intronic
1115582813 14:34778220-34778242 CTAGCTAGGTGGAAATGGGAAGG - Intronic
1116550332 14:46229551-46229573 CAAGGTATGTGGAAATGGGCAGG + Intergenic
1117160588 14:52985726-52985748 GTAGCTAGATGGAGATGAGAAGG + Intergenic
1118412625 14:65497902-65497924 GAAGCTAGGTGGAGAGGGGAAGG + Intronic
1119005724 14:70926036-70926058 ATAACTAGATGGAGATGGGAAGG - Intronic
1121558361 14:94855643-94855665 CTGCACAGGTGGAAATGGGATGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124850081 15:33328232-33328254 CTACATAGGTGGAAATAGGATGG - Intronic
1125526983 15:40382906-40382928 GTAGCTAGGCGGAAGTGGGTGGG - Exonic
1126567165 15:50112772-50112794 CTGGGGAGGTGGAAATGAGATGG - Intronic
1127117351 15:55742249-55742271 CCAGCCAGGAGGAGATGGGAGGG - Intronic
1127180518 15:56411512-56411534 CTAGCTATGTGAAAATGAGTGGG + Intronic
1128855917 15:71015100-71015122 TTATCTAGTTGGAATTGGGATGG + Intronic
1129782563 15:78282839-78282861 CTCGCTAGGTGGGTATCGGAAGG - Intronic
1130518363 15:84643592-84643614 CTTCCTAGATGGAAATGGGATGG - Exonic
1141235607 16:82213208-82213230 CTAACTAGTTGGAAATGTTATGG - Intergenic
1146091182 17:29880082-29880104 CTAGCTAGATGGATAATGGATGG - Intronic
1146745359 17:35323957-35323979 CTGGCAAGGTGGCAAAGGGATGG + Intergenic
1147497980 17:40936384-40936406 CCTACTAGGCGGAAATGGGAAGG - Exonic
1153117005 18:1670468-1670490 ATAGCTAAATTGAAATGGGAAGG - Intergenic
1155094778 18:22544982-22545004 CCAGCCAGGAGGCAATGGGAGGG + Intergenic
1155549871 18:26953551-26953573 CTAGGGAGGTAGAAATGAGAAGG + Intronic
1157567095 18:48686664-48686686 CTGGCTATGTGGAAAGGGAAGGG + Intronic
1160422509 18:78756736-78756758 CTCGCCAGGGGTAAATGGGAAGG - Intergenic
1165689450 19:37852037-37852059 CTTGCTAGGTGGAAAAGAAAGGG - Intergenic
1166512336 19:43417454-43417476 TTAGCTATGTGAAAATGGGGTGG - Intronic
1166972898 19:46582225-46582247 ATAGATAGCTGGAACTGGGACGG - Intronic
1167820219 19:51921051-51921073 CTAGCTAGGTTCAAGGGGGAAGG - Intronic
925327849 2:3036830-3036852 CTGGCTATGGGGAACTGGGATGG + Intergenic
926362994 2:12107638-12107660 TTTGCTAGGTGGAAAAGGGTGGG - Intergenic
926965216 2:18402241-18402263 GTAGCTATGTGGAAATTGGAAGG - Intergenic
927899672 2:26810342-26810364 CTGACTAGGGGGAAATGGAAAGG + Intergenic
928050994 2:27995212-27995234 CTGGCAAAGTGGAAATGGGCTGG + Intronic
928950967 2:36812603-36812625 ATGTCTAGGTGCAAATGGGAAGG - Intronic
929209593 2:39340527-39340549 CCAGTTAGGTTGAAATGGAATGG + Intronic
931691361 2:64837337-64837359 CTAGCTAAAAGGAAAAGGGAGGG - Intergenic
934221598 2:90089143-90089165 CTAGCCAGCTGAAAGTGGGATGG + Intergenic
935799520 2:106679561-106679583 CTAGCAAGGAGGAAAGGCGAGGG + Intergenic
936465583 2:112745963-112745985 CTAGGAAGGGGAAAATGGGAGGG + Intronic
936896593 2:117434653-117434675 CCTGATAGGGGGAAATGGGAGGG + Intergenic
938036185 2:128036983-128037005 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
938036991 2:128043051-128043073 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
939348065 2:140994042-140994064 CAAGCTCGGTGGAAATGTGATGG - Exonic
945964208 2:216168762-216168784 CTTGCAAGGTGGAAATAGCAAGG + Intronic
948797712 2:240413174-240413196 GCTGCCAGGTGGAAATGGGAGGG + Intergenic
1170009391 20:11704963-11704985 CTAGCTGGGAGGAATGGGGAAGG + Intergenic
1174130653 20:48341488-48341510 CTGGCTAGGTGGAGAGAGGAAGG - Intergenic
1175335592 20:58193821-58193843 CTGGCCAGGTAGAGATGGGAAGG - Intergenic
1175996746 20:62815382-62815404 CTTGCCAGGTGGAACTGGTAGGG + Intergenic
1177317991 21:19485420-19485442 CTTGCTAAGGGGAAAGGGGAAGG - Intergenic
1179087257 21:38228679-38228701 ATAACTGGGAGGAAATGGGAAGG - Intronic
1180708555 22:17824379-17824401 AAAGCCATGTGGAAATGGGAGGG + Intronic
950577412 3:13840745-13840767 CTAGATAGATAGTAATGGGAAGG - Intronic
951359297 3:21705548-21705570 CTACCTACGTGGGCATGGGAAGG + Intronic
951499876 3:23373237-23373259 CCAGGTTGGTGGAAATGGAAAGG + Intronic
952299451 3:32091647-32091669 CTAGGTAGGTGGTGGTGGGAGGG - Intergenic
952552664 3:34496703-34496725 CCACCTGGCTGGAAATGGGATGG + Intergenic
954608832 3:51933641-51933663 ACAGCTCGGTGGAAATGGGGTGG - Intronic
955566416 3:60251767-60251789 TTCCATAGGTGGAAATGGGAGGG - Intronic
956744524 3:72300999-72301021 TTAGCTAGGTGCCAAGGGGAGGG - Intergenic
958195293 3:90235635-90235657 CTTCCTAGGTGGAAAAGGGTGGG + Intergenic
958418701 3:93907041-93907063 CTTCCTAGGTGGAAAAGGGTAGG + Intronic
960526982 3:118721241-118721263 CACCCTAGTTGGAAATGGGAAGG + Intergenic
961999703 3:131283085-131283107 CTAGCTATATGGCAATGGGAGGG - Intronic
962102398 3:132356489-132356511 TTTGCAGGGTGGAAATGGGAGGG - Intronic
962395093 3:135008722-135008744 CTAGTTGAGTGGAAATGGCATGG + Intronic
964176294 3:153828304-153828326 CCAGGAAAGTGGAAATGGGATGG + Intergenic
971225625 4:24749000-24749022 CTAAGTGTGTGGAAATGGGAAGG - Intergenic
973324368 4:48843343-48843365 CTATCTATCTGGTAATGGGAAGG + Intronic
975008495 4:69320826-69320848 GTTCCTAGGTGGAAATGGGTGGG + Intronic
978760836 4:112355574-112355596 CTAGGGAGGTGGCAATGGAACGG + Intronic
983642169 4:169953254-169953276 ATAGGTAGATGGACATGGGAAGG + Intergenic
984174955 4:176406098-176406120 AGAGCTAGGTTGAAATGTGAGGG - Intergenic
992891888 5:81211310-81211332 CTAGGTAGGTGGGAAGGGGAGGG - Intronic
995401730 5:111749839-111749861 CTAGCTAGAAGGAACTGGGAAGG - Intronic
997743934 5:136282196-136282218 CTAGGTTGATGGAACTGGGATGG + Intronic
999950593 5:156645679-156645701 ACAACTAGGTGGAAGTGGGAGGG - Intronic
1001003972 5:168033363-168033385 GTAGCTAGGTGGCAGTGGGCAGG + Intronic
1003419982 6:5948603-5948625 TTAGCTAAGTGAAAATGTGAGGG - Intergenic
1005668524 6:28081289-28081311 CCAGCCAGGTGGAACGGGGAGGG + Exonic
1006320959 6:33319201-33319223 CTAGCTATGTGGAAAGGCAAAGG - Exonic
1007949036 6:45853216-45853238 CTAGCTATGTGGTAAAGGGTAGG + Intergenic
1011968066 6:93185232-93185254 TTGGCTAGGTGGATATGAGAAGG - Intergenic
1015122189 6:129711809-129711831 CTATGGAAGTGGAAATGGGAAGG - Intergenic
1022592638 7:31680475-31680497 CTAGCTATGTGGCATTGGCAAGG + Intergenic
1023397118 7:39761672-39761694 CTATCTAGGTGGGAAGGGAAAGG - Intergenic
1025824364 7:64998590-64998612 ATAACTGGGAGGAAATGGGAGGG - Intronic
1032299118 7:130670195-130670217 ATCAGTAGGTGGAAATGGGATGG + Intronic
1032976750 7:137232951-137232973 CCAGCTATGTGGAACTGTGAGGG + Intronic
1033504968 7:141990854-141990876 ATAGCTGGGTGGAAGTGGGAAGG - Intronic
1033800413 7:144895092-144895114 CATGCTATATGGAAATGGGAAGG - Intergenic
1034407293 7:150913564-150913586 CTAGGTAGAAAGAAATGGGAAGG + Intergenic
1034502167 7:151457844-151457866 CAAGAGAGGTGGAATTGGGAGGG + Intergenic
1035332500 7:158105482-158105504 GTAGCTGAGTGGAGATGGGATGG - Intronic
1038463987 8:27743088-27743110 GTTGCTAGTTGGAAATGGAATGG - Intronic
1046201867 8:110937578-110937600 CTAGATAGGGGAAAGTGGGAAGG + Intergenic
1046443948 8:114290949-114290971 CTTGATAGTTGGAAATGGGCTGG + Intergenic
1048566210 8:135600470-135600492 CTAGTTAGATGACAATGGGATGG + Intronic
1050266865 9:3900126-3900148 GTGGGGAGGTGGAAATGGGAAGG + Intronic
1050640799 9:7665427-7665449 CTATCTAAGTGAAATTGGGAAGG + Intergenic
1054715001 9:68548201-68548223 CTAGCTGGGTGGTAGGGGGAGGG + Intergenic
1055638512 9:78300436-78300458 CTGGCTTTGTGGACATGGGAAGG + Intronic
1056271854 9:84954811-84954833 CTGGCTAGGTGGGAAGGGGTGGG + Intronic
1056440354 9:86614904-86614926 CTAGCACGGAGGAAATGAGAGGG + Intergenic
1061863771 9:133481355-133481377 CTAGAAGGGTGGAAATGGGCTGG - Intergenic
1186839833 X:13474336-13474358 CTAGCTGGGTGGAAATGGGTTGG - Intergenic
1187534600 X:20128772-20128794 CTGGCTGGCTGGAAAAGGGATGG - Intronic
1187831472 X:23386879-23386901 CTAAGAAGGAGGAAATGGGATGG - Intronic
1189258056 X:39655552-39655574 TTAGATAGGTGGAGAAGGGAAGG - Intergenic
1189902009 X:45716241-45716263 TTGGCTAGGTTGAGATGGGAAGG - Intergenic
1189917558 X:45871239-45871261 CAAGATAGGTGCAAATTGGATGG + Intergenic
1193397438 X:81002570-81002592 CTAGGTTGATGGAGATGGGAAGG - Intergenic
1194091692 X:89586230-89586252 GTAACTGGGAGGAAATGGGAGGG - Intergenic
1194163376 X:90483436-90483458 ATAGGTAGCTGGAAAGGGGATGG + Intergenic
1194459465 X:94148667-94148689 CTAGCAAGCTGGAGATAGGATGG - Intergenic
1196151084 X:112375215-112375237 CTGGCTAGGAGGAAGAGGGATGG + Intergenic
1200444328 Y:3242293-3242315 GTAACTGGGAGGAAATGGGAGGG - Intergenic
1200509645 Y:4061161-4061183 ATAGGTAGCTGGAAAGGGGATGG + Intergenic
1200981182 Y:9264549-9264571 ATAGCCAAATGGAAATGGGATGG - Intergenic
1201473678 Y:14359064-14359086 CTAGAAAAGTGGAAAAGGGATGG + Intergenic