ID: 1115587287

View in Genome Browser
Species Human (GRCh38)
Location 14:34827342-34827364
Sequence GTTCCATCCATTATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115587282_1115587287 4 Left 1115587282 14:34827315-34827337 CCTCTATTTCTTAACTTCTGCCG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1115587287 14:34827342-34827364 GTTCCATCCATTATGGAAGATGG 0: 1
1: 0
2: 2
3: 41
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115587287 Original CRISPR GTTCCATCCATTATGGAAGA TGG Intronic
900953283 1:5871577-5871599 GTTCCATCCAGGGTGGAAAATGG - Intronic
901160132 1:7170897-7170919 GTTCCAGCAAATATGGAACATGG + Intronic
901550152 1:9989983-9990005 GTTCCACCCCTTATGGGAGGCGG - Intergenic
902729646 1:18361074-18361096 CTTCCATCCTTTCTGGAAGTTGG - Intronic
903939095 1:26916506-26916528 GTTCCAGGAATTATGGAAGCAGG - Intronic
905327426 1:37165795-37165817 GTTCCATTCATTATTGAAAGTGG + Intergenic
906239096 1:44230507-44230529 GTTCAGGCCATTCTGGAAGAGGG - Intronic
907502768 1:54894741-54894763 TTTCCATCCATGATGGCAGCTGG - Intergenic
908943374 1:69463898-69463920 ATTCCAACCATTGTGGAAGATGG - Intergenic
911313661 1:96329110-96329132 GTTACATCCATTTTGGTAGATGG - Intergenic
911903886 1:103540367-103540389 GTTCCAGCCATTTTGGATAAGGG + Intronic
911939658 1:104025915-104025937 GTTCTATCCATTATTGAAAGTGG - Intergenic
912981963 1:114382657-114382679 GTTCTATCCATTATTGAAAGTGG + Intergenic
913251372 1:116914370-116914392 GTGCCAGCTACTATGGAAGAAGG + Intronic
913302258 1:117384639-117384661 GTTCTAGCCATTATTGAAAATGG + Intronic
913464603 1:119127207-119127229 GGTCGATCCATTTTCGAAGAAGG - Intronic
916006778 1:160669092-160669114 GTTCAATCCATTATTGAAAATGG + Intergenic
917448139 1:175123997-175124019 ATTGCCTCCATTCTGGAAGATGG - Intronic
917466624 1:175283434-175283456 GTTCAATCAATTATTGAAAAAGG - Intergenic
917468060 1:175300823-175300845 GTTCTATGCATTATAGAAAATGG - Intergenic
918027331 1:180764389-180764411 GTCCCAAGCATTTTGGAAGAGGG + Intronic
921140941 1:212305615-212305637 GTTCTATCCATTATTGAAAGTGG + Intronic
921846215 1:219885411-219885433 GCTCTATCCATTATTGAAGGTGG - Intronic
922489331 1:226002941-226002963 CTTCCATCCAATAAGGAAGGAGG - Intergenic
922865371 1:228856172-228856194 GTTCTATCCATTATTGAGGTGGG + Intergenic
923558254 1:235018916-235018938 GGACCATTCATTATGGAGGAGGG - Intergenic
923968542 1:239172797-239172819 GTTCCATCAATTATTGATAATGG + Intergenic
1063403400 10:5769794-5769816 GGTCCAGCCACTATGGAAAATGG + Intronic
1063503169 10:6572809-6572831 AGTCCAACCATTGTGGAAGATGG - Intronic
1064127745 10:12678558-12678580 GTTCCATCCATTATTGAAAGTGG + Intronic
1065131770 10:22628936-22628958 GTTCAGGCCATGATGGAAGAGGG - Intronic
1065623617 10:27608771-27608793 GTGCCATCCATTTTGGGAAAAGG + Intergenic
1065963918 10:30755351-30755373 TTTCCATCCTTTAAGGAAGCAGG - Intergenic
1068155761 10:53196050-53196072 ATTACAGCCATTATGGAAAAGGG - Intergenic
1070635307 10:78121172-78121194 GTTCTATCCATTATTAAAGGTGG - Intergenic
1070936499 10:80301908-80301930 GTTCTATCCATTATTGAAAATGG - Intergenic
1071356009 10:84796816-84796838 GTTCTATCCATTATGAAAAGTGG + Intergenic
1071744195 10:88397034-88397056 GTTCTATCCATTATTGAAAGTGG - Intronic
1073850176 10:107606434-107606456 GTTCTATACATTATTGAATATGG - Intergenic
1074192076 10:111146786-111146808 CTTCCTTCTATTATGGAAGGTGG + Intergenic
1074507235 10:114082307-114082329 GTTCCATACATTAAGGCTGATGG + Intergenic
1076689958 10:132218198-132218220 GTTCCAGCCATTCTGGCAGCTGG + Intronic
1078029373 11:7734199-7734221 ATTCTATCCATTATTGAAGGTGG - Intergenic
1078306357 11:10191503-10191525 TTGCGATCCATTATGGAAAAAGG + Intronic
1080180823 11:29424252-29424274 GTTCCATCCATTTGGAGAGAGGG - Intergenic
1080850517 11:36065086-36065108 ATTCTATCCATTATTGAAGATGG + Intronic
1082230976 11:49765797-49765819 ATTTCAACCATTGTGGAAGATGG - Intergenic
1084193964 11:67513020-67513042 GGTACAGCCATTTTGGAAGATGG + Intergenic
1087452168 11:98338426-98338448 GTTCTATCCATTATTGAAAGTGG + Intergenic
1087688251 11:101289663-101289685 GTTCCATCCATTATCGAAAGTGG + Intergenic
1087905452 11:103691297-103691319 ATTCTATCCATTATTGAAAATGG + Intergenic
1088185412 11:107162053-107162075 AGTACATCCATTATGGAAAATGG + Intergenic
1089026976 11:115281109-115281131 GTTTCTTTCATTATGGAAAAGGG + Intronic
1090899255 11:131012455-131012477 CTACCATCCATTATGAGAGAAGG - Intergenic
1092006352 12:5073798-5073820 GTCCCATCCATTGTGGTATAAGG + Intergenic
1093046475 12:14451928-14451950 GTTCTATCCATTATTGAAAGTGG + Intronic
1096733652 12:53635300-53635322 GTTCTATCCATTATTGAAAGTGG + Intronic
1098944657 12:76576119-76576141 GTTCTGTCCATTATTGAAAATGG - Intergenic
1100484397 12:95010758-95010780 GTTATATCCATTATTGAAGGTGG + Intergenic
1100691214 12:97040289-97040311 GTCCCATTCATTGTGGAGGAGGG - Intergenic
1101356125 12:103979026-103979048 GTTCCATACATAGTTGAAGAGGG - Intronic
1101483591 12:105128695-105128717 GTCCCAACCATTTTGGATGAGGG + Intronic
1101483734 12:105129892-105129914 GTTACATGCTTTATGGAACATGG - Intronic
1104408632 12:128539819-128539841 GATCAATACATTTTGGAAGATGG - Intronic
1106985106 13:35337570-35337592 GTTCTATCCATTATTCAAAATGG - Intronic
1107383754 13:39885562-39885584 GTTCTATCCATTATTGAAATTGG - Intergenic
1107933936 13:45329004-45329026 ATTCTTTCCATTTTGGAAGAAGG - Intergenic
1108136228 13:47365393-47365415 GTTCTATCCATTATTGAAAATGG + Intergenic
1109477596 13:62903172-62903194 ATTCTATACATTTTGGAAGAAGG + Intergenic
1110023604 13:70508089-70508111 CTTCAATTTATTATGGAAGAGGG + Intergenic
1111407774 13:87832283-87832305 GCTGCATCCATAATGGAAGAGGG + Intergenic
1112953094 13:105026719-105026741 GTTCTATCCATTATTGAAATTGG + Intergenic
1113042186 13:106116445-106116467 AGTTCATCCATTGTGGAAGATGG + Intergenic
1113117925 13:106893289-106893311 GTTCCATAAATTAAGGAATATGG - Intergenic
1115587287 14:34827342-34827364 GTTCCATCCATTATGGAAGATGG + Intronic
1116192442 14:41678465-41678487 GTTATATCCATTATTGAAAATGG - Intronic
1116612615 14:47096041-47096063 TTTCTCTCCATTTTGGAAGATGG - Intronic
1116725348 14:48555826-48555848 GTTGCACCCATTTTGGAAAATGG + Intergenic
1117318849 14:54601348-54601370 TTTAAATCCATTATGGAAGTAGG + Intronic
1118536232 14:66768696-66768718 GTTCTATCCATTATTGAAAGTGG - Intronic
1118545968 14:66889165-66889187 GTTCTATCCATTATTGAATGTGG - Intronic
1119056389 14:71425769-71425791 GTTCCATCCATTATTGAGAATGG + Intronic
1120604197 14:86552528-86552550 ATTTCAACCATTGTGGAAGATGG + Intergenic
1120804463 14:88731645-88731667 GGTTCAACCATTGTGGAAGACGG - Intronic
1122431044 14:101644228-101644250 GTTCTATCCATTATTAAAAATGG - Intergenic
1124213036 15:27779333-27779355 GTTCCATCTATTATTGAAAATGG + Intronic
1124245361 15:28066392-28066414 GTTCAAGCCATGATGGGAGAGGG + Intronic
1124546763 15:30635902-30635924 ATTCTATCCATTATTCAAGAAGG - Intronic
1124780368 15:32625902-32625924 ATTCTATCCATTATTCAAGAAGG - Intronic
1126217072 15:46168102-46168124 GGTGCAGCCATTATGGAAAATGG - Intergenic
1126358825 15:47824253-47824275 GTGCCAGGAATTATGGAAGATGG - Intergenic
1126452912 15:48829304-48829326 GTTCTATCCATTATTGAAAGTGG + Intronic
1126637624 15:50794631-50794653 GTTCAATCCACTATGAAATATGG - Intergenic
1127172565 15:56318050-56318072 GTTCTATCCATTATTGAAACTGG + Intronic
1130060741 15:80568131-80568153 GTTCCATCAAATATGGAATGAGG + Intronic
1130442956 15:83973789-83973811 ACTCCATCCATTATGGAAGGGGG + Intronic
1131444334 15:92484180-92484202 AGTACATCCATTATGGAAAACGG + Intronic
1131502871 15:92987041-92987063 GTTCTACCCATTATTGAAAATGG + Intronic
1131795576 15:96012692-96012714 GGTACAACCATTCTGGAAGACGG - Intergenic
1131911102 15:97202973-97202995 GATCCATCCATTATTAAAAATGG - Intergenic
1136678284 16:31935890-31935912 GTTCCTACCATTATGAAAGCTGG + Intergenic
1137353981 16:47740349-47740371 GTTCTATCCATTATTGAAAATGG - Intergenic
1138346495 16:56323520-56323542 GTTCCAGGCATTAGGAAAGAGGG + Intronic
1140107599 16:71974868-71974890 GTTCTTTCCAGTATGGAAGGTGG + Intronic
1142911448 17:3096785-3096807 GTTCTATCCATTATTGAAAGTGG - Intergenic
1142924389 17:3221426-3221448 GTTCTATCCATTATTGAAAGTGG + Intergenic
1143931441 17:10432169-10432191 GTTACATCCATTATTGAAAGTGG + Intergenic
1143932376 17:10442957-10442979 GTTCAATCCAGTGTGGAAGACGG - Intergenic
1144140715 17:12344614-12344636 GTTCTACCCATTATTGAAGGTGG + Intergenic
1145027896 17:19482728-19482750 GTTCAGGCCATTATGGAAGAGGG + Intergenic
1152968957 18:142947-142969 GTTCAGGCCATGATGGAAGAGGG + Intergenic
1153684804 18:7535268-7535290 GTTCTATCCATTATCAAAAATGG + Intergenic
1154196249 18:12269519-12269541 GGTCCATTCAAAATGGAAGACGG - Intronic
1154468856 18:14678408-14678430 GGTACAGCCGTTATGGAAGATGG + Intergenic
1155577280 18:27261180-27261202 GTTCTATCCATTATTGAAATTGG + Intergenic
1158260237 18:55598473-55598495 GTTCCATGCATTGTGAAAAAAGG - Intronic
1160180647 18:76632621-76632643 GTTCTATCCATTATTGAAAGGGG - Intergenic
1162160852 19:8714445-8714467 GTTCTATCCATTATTGAAGATGG + Intergenic
1162687310 19:12398772-12398794 TTTGCAGCCATAATGGAAGAGGG + Intronic
1162691624 19:12438603-12438625 TTTGCAGCCATAATGGAAGAGGG + Intronic
1164435472 19:28224859-28224881 GTTACAACCATTCAGGAAGATGG + Intergenic
1165345265 19:35243457-35243479 GTTCTATCCATTATTGAAAGTGG - Intergenic
1167821828 19:51935307-51935329 GTTTCATTCATCATGGAAGATGG - Intronic
1168577665 19:57526882-57526904 GTTCAGGCCATTATGGAAGAAGG - Intergenic
925943672 2:8841656-8841678 GTTCAGGCCATGATGGAAGAGGG - Intergenic
926554207 2:14338090-14338112 GTTCTATCAATTATTGAAAATGG + Intergenic
926813002 2:16772965-16772987 GTGCCATGCATTATGTAAGGGGG - Intergenic
926939149 2:18116702-18116724 GTCCCAAGCATTTTGGAAGAGGG - Intronic
928551290 2:32373651-32373673 GGTGCAGCCATTATGGGAGATGG + Intronic
930556898 2:52907752-52907774 AATTCATCCATTGTGGAAGATGG + Intergenic
931420892 2:62126348-62126370 AGTCCAACCATTGTGGAAGACGG - Intronic
932205464 2:69877122-69877144 ATTCCATCCACAATGGAATAAGG + Intronic
932943162 2:76194030-76194052 TTTCCTTCCAGTTTGGAAGAAGG + Intergenic
933418393 2:82017164-82017186 TTTCCATACATTATTGAAAATGG + Intergenic
933641988 2:84772712-84772734 GTTCTATCCCTTATTAAAGATGG - Intronic
934997344 2:98977279-98977301 GTTCTATCCATTATTGAAAGTGG - Intergenic
935088403 2:99870427-99870449 GTTTCACACATGATGGAAGAGGG - Intronic
935181851 2:100698491-100698513 GTTCTATCCATTACGGAAAGTGG - Intergenic
935887619 2:107640003-107640025 GGTGCAGCCATTATGGAAAATGG - Intergenic
936379498 2:111971869-111971891 GTTCCATCTGTTATTGAAAATGG + Intronic
937568402 2:123326087-123326109 GCTCTATCCATTATTGAACATGG + Intergenic
937777893 2:125802663-125802685 GTTCTATCCATTATTGAAAGTGG - Intergenic
938028044 2:127967718-127967740 GTTTCATCCATTATTGAAAGTGG - Intronic
938142119 2:128803282-128803304 GTTCAGGCCATGATGGAAGAAGG - Intergenic
938963967 2:136370360-136370382 GATTCAGCCATTATGGAAAATGG + Intergenic
939500486 2:142977133-142977155 GTTCAAGCCATGATGGAAGAGGG - Intronic
943442417 2:187942375-187942397 TGTTCATCCATTATGGATGAGGG - Intergenic
943460125 2:188162745-188162767 GTGCTTTCCATTTTGGAAGATGG - Intergenic
944179796 2:196878167-196878189 GTTCCATGCATTTTGGATGAGGG - Intronic
944766176 2:202866332-202866354 GTTTCTTCCATCATGGAGGAAGG - Intronic
944825716 2:203481329-203481351 GTTCCTTCCATTGTAAAAGAGGG + Intronic
945389741 2:209249653-209249675 GGTCTATCCATTATGAAAGTTGG - Intergenic
946074252 2:217060956-217060978 GTTGTAGGCATTATGGAAGATGG + Intergenic
946954539 2:224914667-224914689 CTTTCATCCTTTATGAAAGATGG - Intronic
1169505355 20:6205102-6205124 GTTCTATCCATTATTGAAAGTGG + Intergenic
1169780823 20:9307851-9307873 GTTCCCTCCTTTTTGCAAGAAGG + Exonic
1169824558 20:9753023-9753045 GTTCCAGCCATCCTAGAAGAGGG + Intronic
1170263429 20:14438489-14438511 GCTACAGCCATTATGGAAAATGG - Intronic
1170637497 20:18120295-18120317 GTTCTATCCATTATTGAAAGTGG - Intergenic
1170807333 20:19644029-19644051 GTTCTATCCATTATACAAAAGGG + Intronic
1171049767 20:21845166-21845188 GTTCTATCTATTATGGAGAATGG - Intergenic
1171342494 20:24441478-24441500 TTACCATCCATGAAGGAAGAGGG + Intergenic
1171726695 20:28628550-28628572 GTTCTATCCATTATTGAATTTGG - Intergenic
1171790764 20:29521815-29521837 GTTCTATCCATTATTGAATTTGG - Intergenic
1171856944 20:30355023-30355045 GTTCTATCCATTATTGAATTTGG + Intergenic
1173144984 20:40516650-40516672 GGTTCAACCATTGTGGAAGACGG - Intergenic
1178238539 21:30872206-30872228 ATTTCAACCATTGTGGAAGACGG - Intergenic
1178756843 21:35358690-35358712 GTTACATCCTTTGTGGAAGAAGG + Intronic
1178781359 21:35605758-35605780 GTTTCATCCATTAGGAAAGAAGG - Intronic
1179009129 21:37540634-37540656 GTTCCAAGCATTTTGGATGAGGG + Intergenic
1180941832 22:19664532-19664554 GGTCCAGCTATTTTGGAAGACGG + Intergenic
1181148748 22:20867476-20867498 GTTCCAACCAATGAGGAAGAAGG - Intronic
1181441433 22:22937694-22937716 GTTCCATGAATGATGGAAGTTGG + Intergenic
1182195535 22:28512339-28512361 AGTTCAACCATTATGGAAGACGG + Intronic
1183536077 22:38402152-38402174 CTTCCAACCCTTATGGAAGGAGG - Intergenic
949200462 3:1372319-1372341 GTAACATCCATTTTGGAAGGTGG - Exonic
949273180 3:2245036-2245058 ATTGTATCTATTATGGAAGACGG - Intronic
951885332 3:27518783-27518805 GTTCTACCCATTATGGAAAGTGG + Intergenic
953204403 3:40810590-40810612 GTTGCATCCATTATTGAAGTTGG + Intergenic
953690174 3:45111087-45111109 TTTACATCCACTATGGAAGTGGG - Intronic
954836002 3:53468538-53468560 ATTTCAACCATTGTGGAAGATGG - Intergenic
955262000 3:57400787-57400809 GTTCTATCCATTATTGAAAGTGG - Intronic
955977637 3:64493358-64493380 TTTGCATCCTTTCTGGAAGAGGG + Intergenic
957576833 3:82018489-82018511 GTTCAGACCATGATGGAAGAGGG + Intergenic
958454097 3:94308352-94308374 GTCCCATTCTTGATGGAAGAAGG + Intergenic
958921907 3:100116519-100116541 CCTCCATCCATTATGGAAAATGG + Intronic
959507715 3:107174607-107174629 GTTCTATTCATTATTGAAAATGG - Intergenic
959741581 3:109726531-109726553 GGTTCAACCATTGTGGAAGATGG - Intergenic
959846020 3:111034822-111034844 CTACCATGCTTTATGGAAGAGGG + Intergenic
960226230 3:115172425-115172447 ATTCTATCTATTCTGGAAGAGGG - Intergenic
961113605 3:124308238-124308260 GTTCCATCCATTATTAAAAGGGG - Intronic
962305202 3:134280035-134280057 GTTCCAGCCAGTCTGGAAGAGGG - Intergenic
962402665 3:135074801-135074823 GTCACATGCAGTATGGAAGAAGG - Intronic
962997395 3:140644191-140644213 GGTTCAACCATTGTGGAAGATGG - Intergenic
965078589 3:164009241-164009263 GTTTCTTCCATTAAGGAATAGGG - Intergenic
966479571 3:180391117-180391139 GTTCCAGCCATTATGAAGCAGGG + Intergenic
968243293 3:197113335-197113357 GTTCTATCAATTAAAGAAGAGGG + Intronic
971650743 4:29270038-29270060 GTTACATCCATTGTGTAACAAGG + Intergenic
972357517 4:38294486-38294508 GCCCCATTCATTTTGGAAGAAGG - Intergenic
972470390 4:39398158-39398180 GGTGCAGCCATTGTGGAAGAGGG - Intergenic
974218011 4:58926131-58926153 ATTCTATCCATTATTGAAAATGG - Intergenic
974541424 4:63242906-63242928 GTTCCATCTATTATTGAAAATGG - Intergenic
975235063 4:71984618-71984640 GTTCCAAACATTTTGGATGAGGG - Intergenic
975873572 4:78809022-78809044 GTTCCATTCATTATTGAAAGAGG + Intronic
976617804 4:87095966-87095988 GTTCCATGTATTTTGGAAGGTGG + Intronic
977178982 4:93849943-93849965 GTTCTATCAATTATTGAAAAAGG - Intergenic
977963765 4:103118151-103118173 GGTACAGCCATTTTGGAAGATGG - Intronic
979072562 4:116227749-116227771 GTTCCATCCATTATGTTCAAAGG - Intergenic
979924815 4:126548163-126548185 GTTATATCCATTTTGGGAGAGGG + Intergenic
980710168 4:136555952-136555974 GTTTAATCCATGATGGAAGAAGG - Intergenic
981283456 4:142988057-142988079 GTTCTATCCATGATTGAAAATGG + Intergenic
981939496 4:150267113-150267135 GTTCCACCCATTATTGAAAGTGG - Intronic
982334614 4:154220166-154220188 GTTCTATCCTTTTTGGAGGAGGG + Intergenic
982799792 4:159690726-159690748 GTTCTATCCATTATTGAGGTAGG - Intergenic
982884337 4:160759512-160759534 AGTTCAACCATTATGGAAGACGG + Intergenic
984301163 4:177919662-177919684 TTTTCATCCATTATTGAATATGG + Intronic
984598852 4:181703763-181703785 CTTCCATCCATTAAAGAGGAAGG - Intergenic
986219343 5:5753525-5753547 GTTCAGGCCATGATGGAAGAGGG - Intergenic
987922802 5:24305841-24305863 AGTTCAACCATTATGGAAGACGG - Intergenic
988639300 5:33023641-33023663 TTTTCATCCATCAAGGAAGATGG + Intergenic
989403019 5:41029051-41029073 GGTGCATCCATTATGGAAAACGG - Intronic
989573558 5:42968121-42968143 GGTTCAACCATTGTGGAAGATGG + Intergenic
989729023 5:44625657-44625679 GGTTCAACCATTGTGGAAGATGG + Intergenic
989975544 5:50582255-50582277 ATTTCAACCATTGTGGAAGATGG + Intergenic
990317779 5:54600392-54600414 AGTTCAACCATTATGGAAGATGG + Intergenic
990928016 5:61051731-61051753 CTTACATCCTTTCTGGAAGAAGG - Intronic
994494359 5:100490891-100490913 GGTACAACCATTATGGAAAATGG + Intergenic
994888261 5:105594924-105594946 GGTGCAACCATTATGGAAAAGGG - Intergenic
995197291 5:109385757-109385779 GTTCCAAGCATTTTGGAAAAGGG - Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995464907 5:112441532-112441554 ATTTCAACCATTGTGGAAGACGG + Intergenic
995612058 5:113921453-113921475 ATTCAATCCATTATTGAAGAAGG - Intergenic
996073044 5:119156751-119156773 AGTACAGCCATTATGGAAGAGGG - Intronic
996279570 5:121712163-121712185 CTACCATCCATTTTAGAAGATGG + Intergenic
997007375 5:129833949-129833971 CTTCCAACCATTCTTGAAGAAGG - Intergenic
997769163 5:136537630-136537652 GTTCTATCCACTATTGAAAATGG - Intergenic
1003467171 6:6391934-6391956 GTTGCATCCAATATGGATCATGG - Intergenic
1005656710 6:27946150-27946172 GGAATATCCATTATGGAAGATGG - Intergenic
1008340739 6:50360923-50360945 GTTCCACCTATTATTGAAAAGGG - Intergenic
1008841360 6:55908855-55908877 GTTCCAAGCATTTTGGAAAAGGG + Intergenic
1008967871 6:57332442-57332464 GTTCTATCCATTATTGAAAGTGG + Intronic
1009442923 6:63703699-63703721 TTTGCATTCATTATGAAAGAAGG + Intronic
1012619474 6:101323341-101323363 ATTTCAACCATTGTGGAAGACGG + Intergenic
1012704674 6:102506928-102506950 GTTCCATCAATCATATAAGATGG - Intergenic
1013695659 6:112699914-112699936 GTTTCTACTATTATGGAAGATGG - Intergenic
1014362960 6:120503484-120503506 GTTCTATTCATTATTGAAAATGG + Intergenic
1014578446 6:123104256-123104278 GTTTCATCCACTATGGAAAGTGG - Intergenic
1014661620 6:124179825-124179847 GTGTCATCCATTATTTAAGAAGG - Intronic
1014700133 6:124676395-124676417 GTTCTATCCATTATTGAATGTGG + Intronic
1015305907 6:131708115-131708137 GTTCTATCAATTATTGAAAAAGG + Intronic
1017287429 6:152692094-152692116 GGTACAGCCATTATGGAAAATGG - Intergenic
1017338603 6:153292119-153292141 GATCTATCCATTTTGGTAGAAGG + Intergenic
1018658112 6:166059586-166059608 ATTTCAACCATTGTGGAAGATGG - Intergenic
1018779572 6:167050466-167050488 GTTCTATCCATCATTGAAAATGG + Exonic
1019087358 6:169491175-169491197 GCTCCAGCCATTATCCAAGAAGG + Intronic
1019968223 7:4518635-4518657 GTTCTATCCATTATTGAGAATGG - Intergenic
1020587852 7:10093109-10093131 GGTACAGCCATTTTGGAAGACGG - Intergenic
1021310183 7:19085202-19085224 GTTCTATCCATTATTGAAAGTGG - Intronic
1022585888 7:31610523-31610545 GTTTCATCCATTATTGAAAGTGG + Intronic
1023654653 7:42407286-42407308 TTTCCATACATAATGGGAGATGG + Intergenic
1023910365 7:44551111-44551133 GTTCCATCAATTATTGAAAATGG - Intergenic
1024955679 7:54917185-54917207 GGAACAACCATTATGGAAGAAGG + Intergenic
1026514276 7:71054267-71054289 ATTACAGCCATTATGGAAAACGG + Intergenic
1027763229 7:82306363-82306385 GTTCCATCCCTTTAAGAAGAAGG + Intronic
1027827774 7:83137943-83137965 TTTCCTTCCATTAAGGAAAATGG - Intronic
1028635152 7:92980034-92980056 GATCCAATCATTATGGATGAGGG - Intergenic
1029840653 7:103359625-103359647 GTTCCATCTATTTTAGAATACGG - Intronic
1031543148 7:123020267-123020289 GTTCCACCCATTATTGAGAATGG + Intergenic
1032421589 7:131784243-131784265 GTTACAGCCATTATGGAAAATGG - Intergenic
1032423928 7:131805188-131805210 GATACAGCCATTATGGAAAACGG - Intergenic
1033097754 7:138445722-138445744 GTACCATCCAGTCTGGAAGGGGG + Intergenic
1033731643 7:144186385-144186407 GTTCTATCAATTATTGAAAAAGG - Exonic
1033740022 7:144266348-144266370 GTTCTATCAATTATTGAAAAAGG + Intergenic
1034734612 7:153416963-153416985 GCTACATCCAGTGTGGAAGAGGG - Intergenic
1035567790 8:653012-653034 GGTACAGCCATTGTGGAAGACGG + Intronic
1035642276 8:1193249-1193271 GGTTCAACCATTGTGGAAGACGG - Intergenic
1036641456 8:10586700-10586722 GTTCAATCCATTTTGCAGGACGG + Intergenic
1037052051 8:14385877-14385899 GTTCAATCCTTTATGTAAAATGG + Intronic
1037367784 8:18141277-18141299 GTTCTATACATTTTGGGAGACGG - Intergenic
1039014975 8:33137236-33137258 GTTCCAGCCACTATAGAACATGG - Intergenic
1040655748 8:49505808-49505830 AGTTCATCCATTGTGGAAGAGGG + Intergenic
1040689055 8:49911866-49911888 TTTTCATCCATTAAGGAAGGGGG - Exonic
1043105348 8:76102852-76102874 GGTACATCCACTTTGGAAGATGG - Intergenic
1044369548 8:91392561-91392583 GTTCCAGCCACCATGGAAGAAGG + Intronic
1045700785 8:104863735-104863757 GTTCTATCCATTATTAAAGGTGG - Intronic
1045926918 8:107585625-107585647 ATTACATCCAATATTGAAGAAGG - Intergenic
1047242212 8:123100936-123100958 ATTGCATCTATTATGGAAAATGG + Exonic
1047327673 8:123855199-123855221 GTTCCAGGCATCATGGGAGAGGG + Intronic
1047340328 8:123974863-123974885 GTTCCATCTTTGATGGAATAGGG - Intronic
1047639886 8:126807202-126807224 GTTCTATCCATTATTGAAAATGG + Intergenic
1050444702 9:5707441-5707463 GTTCTATCCATTATTGAAAGTGG + Intronic
1050889013 9:10799488-10799510 GTTCTATCCATTATAAAAGTGGG + Intergenic
1052453132 9:28658310-28658332 GTTCTATCCATTATTGAAAGTGG + Intronic
1053723045 9:40968553-40968575 GTTCTATCCATTATTGAATTTGG + Intergenic
1054342922 9:63883443-63883465 GTTCTATCCATTATTGAATTTGG - Intergenic
1054720794 9:68601853-68601875 CTTCCATCCATTTTGGAAGTTGG - Intergenic
1054911375 9:70458339-70458361 GTTCAGGCCATAATGGAAGAGGG - Intergenic
1055798949 9:80010458-80010480 GTTCTATCCATTATTGAAAATGG + Intergenic
1056316443 9:85395093-85395115 TTTCCATTGATTATAGAAGAAGG - Intergenic
1056483336 9:87029202-87029224 GGTTCAACCATTGTGGAAGACGG + Intergenic
1056544884 9:87605388-87605410 GTTCCACCCAGTTTGCAAGAGGG + Intronic
1056920119 9:90780076-90780098 GTTCAATCCATGATGGAAGTAGG - Intergenic
1058954465 9:109932380-109932402 GAGCCATCCATGATGGAAGCTGG + Intronic
1059283970 9:113157169-113157191 GTGCCAAGCATTATGGAAGTAGG - Intronic
1059572105 9:115449914-115449936 GTTCTATCAATTATTGAAAAAGG + Intergenic
1061694310 9:132360282-132360304 GTTACATCCATTATTGAAAATGG + Intergenic
1203452100 Un_GL000219v1:127429-127451 GTTCTATCCATTATTGAATTTGG - Intergenic
1185749151 X:2596771-2596793 CATCCATAAATTATGGAAGAGGG - Intergenic
1186007512 X:5089624-5089646 GTTCAAGCCATGATGGAAGAGGG + Intergenic
1187183119 X:16962048-16962070 GGTACAGCCATTATGGAAAATGG + Intronic
1187285094 X:17897449-17897471 GGTCCATCCATAGTAGAAGAGGG - Intergenic
1188602628 X:31987752-31987774 AGTACATCCATTATGGAGGACGG + Intronic
1191699806 X:64028916-64028938 GTTCTATCCATTATTGAAAGTGG + Intergenic
1191739919 X:64425653-64425675 GTTCAGGCCATGATGGAAGAGGG - Intergenic
1191790089 X:64961021-64961043 GTTCCATCCATTATTAAAAGTGG + Intronic
1192353460 X:70377372-70377394 GTTCTATCCATTATTAAAGTAGG - Intronic
1192918070 X:75675296-75675318 GTTCTATCCATTATTGAAAGTGG - Intergenic
1193698052 X:84733470-84733492 GTTATATCCATTATTGAATATGG + Intergenic
1194006090 X:88494507-88494529 GTTCCATCCATTATTGAAAATGG + Intergenic
1194342770 X:92725553-92725575 GTTCTATCCATTATTGAACATGG - Intergenic
1194747677 X:97646875-97646897 GTTCTACCCATTATTGAAAATGG + Intergenic
1194891815 X:99388310-99388332 GTTCTATCCATTATTGAAAATGG + Intergenic
1194989669 X:100533611-100533633 GTTCTATCCATTATTGAAAGTGG + Intergenic
1195362611 X:104098661-104098683 GGTACAGCCATTATGGAAAACGG + Intergenic
1196051168 X:111306497-111306519 GTTCTATCCATTATTGAAAGTGG - Intronic
1196239178 X:113320480-113320502 GTTCTATTCATTATTGGAGATGG - Intergenic
1196360186 X:114844934-114844956 GTTCTGTCCATTATTGAAAATGG - Intronic
1197020557 X:121682788-121682810 GCTCCAACAATTTTGGAAGATGG - Intergenic
1197111922 X:122785739-122785761 GTTTTATCCATTATTGAAGGTGG + Intergenic
1197296037 X:124720186-124720208 ATTCAAGCCATGATGGAAGATGG + Intronic
1197861447 X:130975194-130975216 TTTCCATTCATTATGGAAAGGGG + Intergenic
1197905356 X:131419267-131419289 GGTTCAACCATTGTGGAAGATGG + Intergenic
1198823403 X:140673574-140673596 GTTCCATCTACTATGCAGGATGG + Intergenic
1200392403 X:155957335-155957357 GTTCAGACCATTGTGGAAGAGGG + Intergenic
1200651130 Y:5842218-5842240 GTTCTATCCGTTATTGAACACGG - Intergenic
1201428550 Y:13881925-13881947 GTTCCCTACATTATGAAACAAGG - Intergenic
1201673117 Y:16547619-16547641 GTTCAGGCCATGATGGAAGAGGG - Intergenic
1202332923 Y:23773578-23773600 GGTCCAACCATTGTGGAAGACGG - Intergenic
1202537846 Y:25896485-25896507 GGTCCAACCATTGTGGAAGACGG + Intergenic