ID: 1115587536

View in Genome Browser
Species Human (GRCh38)
Location 14:34829589-34829611
Sequence TTGTAGGAATGGTAGGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115587536 Original CRISPR TTGTAGGAATGGTAGGGAAG TGG (reversed) Intronic
900438189 1:2641198-2641220 TTGTGGGGAGGGTTGGGAAGGGG + Intronic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
901017347 1:6239574-6239596 TGGCAGGAAGGGGAGGGAAGGGG - Intergenic
903554231 1:24181428-24181450 TTAAAGGAATGGGTGGGAAGTGG - Intronic
903938728 1:26914094-26914116 TGGCAGGAATGGTGGGGAAGTGG + Intronic
904212907 1:28897563-28897585 AGGTAGGAAGGGAAGGGAAGCGG + Intronic
906708726 1:47913681-47913703 AGGTAGGAAAGGAAGGGAAGAGG - Intronic
908414938 1:63904060-63904082 GTCAGGGAATGGTAGGGAAGCGG + Intronic
910340809 1:86184802-86184824 TTGCAGGAATGGTGGGGGATGGG - Intergenic
910368839 1:86494585-86494607 ATGTAGGAATTGTGGGGAAATGG - Intronic
911427811 1:97742474-97742496 TTAGAGAAATGATAGGGAAGAGG - Intronic
912230482 1:107787217-107787239 TTATAGAAAGGGTAGTGAAGTGG - Intronic
912967192 1:114246766-114246788 TTGTAGAAGTTGTAAGGAAGGGG - Intergenic
913328751 1:117650265-117650287 CTGGAGGAGTGGTAGGGGAGAGG - Intergenic
913540385 1:119814412-119814434 GTGTAGGTGTGGTAGGGAAGGGG + Intergenic
915144220 1:153785295-153785317 CTGTAGGAAAGGGAGGGATGCGG - Intergenic
916644480 1:166769448-166769470 TTGTAGGTATGGTAGGTCATAGG - Intergenic
917354033 1:174107280-174107302 TTGGAGGTATGGTTGGGATGAGG - Intergenic
918325213 1:183403517-183403539 TGGAAGGAATGGTGGGGAGGTGG - Intronic
918554740 1:185784867-185784889 TGGTAGGATTGGCAGAGAAGGGG - Intronic
918972591 1:191438959-191438981 TTGAAGGAAAGGGTGGGAAGGGG + Intergenic
920362989 1:205432131-205432153 TTGGAAGAAGGGTAGGGAAAAGG + Intronic
920544213 1:206802025-206802047 TTGCAGGAAAGGAGGGGAAGGGG + Intronic
920556836 1:206910074-206910096 GTGTAGGGAAGTTAGGGAAGTGG - Intronic
920677492 1:208048352-208048374 TTTCAGGAATGGTAGGAGAGAGG - Intronic
920888933 1:209963391-209963413 TTGGAAGGAGGGTAGGGAAGAGG + Intronic
920979768 1:210822227-210822249 TTAGAGGTATGGCAGGGAAGTGG + Intronic
921708783 1:218352741-218352763 ATTTAGAGATGGTAGGGAAGAGG - Intronic
921962961 1:221055385-221055407 ATGTAGGTTTGGTAGGGAAAAGG - Intergenic
923945143 1:238877402-238877424 TCGGAGGAAAGGTAGGGAGGAGG - Intergenic
924744546 1:246819362-246819384 TTGTAGGGAGGGGAGGGGAGGGG - Intergenic
1063953682 10:11247008-11247030 TTGTGGGGATGGTGGAGAAGGGG - Intronic
1064159611 10:12933202-12933224 TTCTAGGAATTGTAGGGAGCTGG + Intronic
1064324354 10:14334710-14334732 TTGTATTTTTGGTAGGGAAGGGG - Intronic
1064380801 10:14839271-14839293 TTGTAGAAATGGGAAGAAAGGGG + Intronic
1064891316 10:20177316-20177338 CTGGAGGCATGCTAGGGAAGAGG - Exonic
1065013555 10:21441267-21441289 ATGAATGAATGGTAGAGAAGAGG + Intergenic
1065708278 10:28491252-28491274 GTGTAGGACTGGAAGGGAGGAGG + Intergenic
1066513262 10:36125747-36125769 TTGGAGAAATGGCAGGGATGTGG + Intergenic
1066728231 10:38412872-38412894 TTGTATTTTTGGTAGGGAAGGGG + Intergenic
1067542047 10:47162125-47162147 GTCTGGGAGTGGTAGGGAAGTGG - Intergenic
1068844884 10:61660814-61660836 TTTTAGGACTGGAAGAGAAGAGG - Intergenic
1070123407 10:73600318-73600340 GTGTAGGGGTGGAAGGGAAGTGG + Intronic
1070471037 10:76779697-76779719 TTGTAGAACGGGTAAGGAAGAGG + Intergenic
1070711034 10:78683365-78683387 TGGGAGGAATGGAAGGGAAGGGG + Intergenic
1072165994 10:92813690-92813712 TTGTAGGCAAGGGAGGGAAGGGG - Intergenic
1073193095 10:101666198-101666220 TTCTAGCAATCGTAGGAAAGAGG - Intronic
1074421745 10:113315173-113315195 TTCCAGGGATGGTAGGGAGGGGG - Intergenic
1074616787 10:115077637-115077659 TTATAGGAAAAGTAGGGAAGTGG - Intergenic
1075956650 10:126529190-126529212 TTGTAGGTATGGTAAGGAAAAGG - Intronic
1076489701 10:130850052-130850074 GGGAAGGAATGGGAGGGAAGGGG - Intergenic
1077072847 11:685050-685072 ATTTATGAATGGTAGGTAAGTGG - Intronic
1078801566 11:14650163-14650185 TTGTATGAAATGTAAGGAAGAGG - Intronic
1078864763 11:15287167-15287189 TTGAGGGAATGGTGGTGAAGAGG - Intergenic
1080176398 11:29368057-29368079 ATTTAAAAATGGTAGGGAAGGGG - Intergenic
1083369178 11:62164905-62164927 CTGCGGGAATGGTAGGGAAAGGG + Intergenic
1084794452 11:71495861-71495883 TGGTAGGAATGAGAGGGAATGGG + Intronic
1085572067 11:77568525-77568547 TTGTGGAAAGGGGAGGGAAGAGG - Intronic
1086420641 11:86634068-86634090 TTGTAGGAATGGAAGGAGAGGGG - Intronic
1087463889 11:98479684-98479706 TTGTTGGAATTGTAGGCAGGAGG + Intergenic
1087821619 11:102718903-102718925 TTGTGGGAATGCAAGAGAAGAGG - Intronic
1090930735 11:131295929-131295951 GTGTAGGAATTGTTGGGAAGAGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091553574 12:1554849-1554871 ATGTGGCAATGGGAGGGAAGGGG + Intronic
1091856703 12:3746391-3746413 GTGGAGGAAGGGTGGGGAAGAGG - Intronic
1092097692 12:5857236-5857258 TTTTAGGCATAGTAGGGGAGTGG + Intronic
1092392911 12:8097244-8097266 TAATAGGAATGGCAGGGCAGAGG - Exonic
1092725699 12:11483601-11483623 TTGGAGGTATGGTAGGTATGTGG - Intronic
1092984591 12:13833715-13833737 GGGTAGGAATGGGAGTGAAGTGG - Intronic
1092989657 12:13883379-13883401 TGGTAGGAATGGTAAGAATGTGG - Intronic
1093122403 12:15287560-15287582 TTGTCATAATGGTGGGGAAGAGG + Intronic
1095176818 12:39101988-39102010 TTGAGGGAATGGGAGGGAAAGGG + Intergenic
1095218793 12:39583030-39583052 TTGTATGTTTTGTAGGGAAGTGG + Intronic
1095768569 12:45924770-45924792 TTGTTGGGATGGTGGGGGAGGGG + Exonic
1096076327 12:48807798-48807820 TTGTAGTTATAGTAGTGAAGGGG - Intergenic
1096539948 12:52301535-52301557 AGGTTGGAATGGAAGGGAAGGGG - Intronic
1096576639 12:52556942-52556964 TTGTAGGAAAGGGAGGGAGTGGG + Intergenic
1096699457 12:53372512-53372534 TTGGAGGCATGGTGAGGAAGAGG - Intergenic
1096790408 12:54041021-54041043 TTAAAAGAATGGAAGGGAAGGGG - Intronic
1097100914 12:56588761-56588783 CTGTAGGAAGGTTGGGGAAGTGG + Intronic
1097342476 12:58454481-58454503 TGGAAGGAAGGGAAGGGAAGGGG - Intergenic
1097819162 12:64110226-64110248 TGGTAGGAATGGTATGGAGGGGG - Intronic
1098042632 12:66367879-66367901 TTGTAGACATGGGAGGGAAGTGG - Intronic
1098171442 12:67751077-67751099 ATGTAGGTCTGGGAGGGAAGTGG + Intergenic
1098894982 12:76048858-76048880 TTGTAGGAGTGTTCGGGAACTGG - Intronic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1099344548 12:81481709-81481731 TTGTATGAGTTGTAAGGAAGTGG - Intronic
1100517472 12:95342270-95342292 TTGGAAGAATGGTATGGAAAGGG - Intergenic
1104362889 12:128150673-128150695 TTGCAGGAATCCAAGGGAAGAGG - Intergenic
1104761643 12:131300523-131300545 GTGTATGATTGGCAGGGAAGTGG + Intergenic
1104818130 12:131660269-131660291 GTGTACGATTGGCAGGGAAGTGG - Intergenic
1104866096 12:131955452-131955474 TTGTATTATTGGTAGGGATGGGG + Intronic
1106169304 13:27275305-27275327 TTGTAGGCATGGCAGGGACTAGG - Intergenic
1107516638 13:41135889-41135911 TTGTAAGGCTGGTTGGGAAGTGG - Intergenic
1108433218 13:50375654-50375676 ATGGAGGAAGGGAAGGGAAGGGG - Intronic
1109023306 13:57127806-57127828 TGGCAGGAGGGGTAGGGAAGAGG + Intergenic
1110081839 13:71323073-71323095 TTGTAGGAAAGTTACTGAAGAGG - Intergenic
1111793521 13:92888389-92888411 CTGCAGAATTGGTAGGGAAGGGG - Intergenic
1115587536 14:34829589-34829611 TTGTAGGAATGGTAGGGAAGTGG - Intronic
1115639542 14:35324364-35324386 TTTTTGGGATGGTTGGGAAGGGG - Intergenic
1117443272 14:55779737-55779759 TTGTAGTTTTGGTAGAGAAGGGG + Intergenic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1120586842 14:86322293-86322315 TGGTGGGAAGGGCAGGGAAGGGG - Intergenic
1122970448 14:105150073-105150095 TGGTAGGGGTGGTGGGGAAGGGG + Intronic
1123130364 14:105980906-105980928 ATGTATGAATGGAGGGGAAGTGG - Intergenic
1126209965 15:46090725-46090747 TTCTTAGAATGGTAGGGAAAGGG + Intergenic
1128915922 15:71562374-71562396 TGGTAGGAAGGGAAGGGAAGGGG + Intronic
1128916357 15:71566617-71566639 GGGTAGGAAAGGTAGGGATGGGG - Intronic
1133107864 16:3525367-3525389 TTGAAGGAAGGGTAGGGTAGAGG - Intronic
1133206537 16:4237488-4237510 TTGTAGGAAGAGTAGGGAGGGGG - Intronic
1133690994 16:8214911-8214933 TTTTAGGAATGGGATAGAAGTGG + Intergenic
1134426189 16:14148365-14148387 TTATAGGTATGGTAGAGAACAGG - Intronic
1136293223 16:29288171-29288193 TTGGGGGAATCGGAGGGAAGAGG + Intergenic
1136552935 16:30991124-30991146 TTGTAGGAATGTTACTGATGAGG - Exonic
1137463473 16:48686887-48686909 TTGTAGGCTGGGCAGGGAAGAGG + Intergenic
1140185070 16:72761939-72761961 TGGTAAGTATTGTAGGGAAGAGG - Intergenic
1140270397 16:73460107-73460129 GAGTGGGAATGGGAGGGAAGGGG - Intergenic
1141459690 16:84170657-84170679 TTGTAGTTTTGGTAGGGATGAGG - Intronic
1141940160 16:87270591-87270613 TTGAAGGAATGAGAGAGAAGTGG - Intronic
1142820076 17:2458977-2458999 TTGTATTATTTGTAGGGAAGGGG + Intronic
1143284766 17:5780948-5780970 CTGAAGGAATGGGAGTGAAGAGG + Intronic
1144033720 17:11344932-11344954 TGGTAGGAAAGGTCGGAAAGAGG - Intronic
1144589540 17:16512593-16512615 ATGTAGGAGTGGTGGGGGAGGGG - Intergenic
1145180489 17:20746055-20746077 CTGTAGAAATGATGGGGAAGAGG + Intergenic
1145357810 17:22178720-22178742 TTGTATTTTTGGTAGGGAAGGGG + Intergenic
1147139288 17:38452364-38452386 ATGGTGGAATGGGAGGGAAGGGG + Intronic
1147804282 17:43118936-43118958 TTGTATTTTTGGTAGGGAAGGGG + Intronic
1147809272 17:43155705-43155727 TTGTATTTTTGGTAGGGAAGGGG + Intergenic
1147901580 17:43789779-43789801 TAGAAGGAAGGGAAGGGAAGGGG - Intergenic
1148718983 17:49737137-49737159 TTGCAGGAAGGGTAAGAAAGAGG - Intronic
1149840087 17:59955028-59955050 CTGTAGAAATGATGGGGAAGAGG + Intronic
1150002730 17:61451839-61451861 TGGTGGGCATGGTAGGGAAGCGG + Intergenic
1150514667 17:65795637-65795659 TTGTACTTTTGGTAGGGAAGAGG - Intronic
1150992017 17:70270652-70270674 TTCTAGTAATGCAAGGGAAGCGG - Intergenic
1152799305 17:82323534-82323556 TTGCAGGAAAGGGAGGGGAGGGG + Intronic
1153718812 18:7880502-7880524 TTGTAGGAAGGGCATAGAAGAGG + Intronic
1155013000 18:21801293-21801315 TTGTGGGCATGGGATGGAAGTGG - Intronic
1155253597 18:23974557-23974579 TTGTAGAAAGTGTAAGGAAGGGG + Intergenic
1155644639 18:28062798-28062820 TTGTAGTTTTGGTAGAGAAGGGG - Intronic
1156075633 18:33275632-33275654 TTGGAGGAAGGGTAGGAAAGGGG + Intronic
1157530161 18:48413588-48413610 TTGTAAAAATGGTAGGGAAGTGG - Intergenic
1157825467 18:50808305-50808327 TTCTAAGGATGGTAGGGAGGTGG - Intronic
1157855330 18:51100087-51100109 TTGTGGGAATGATATGGGAGGGG + Intergenic
1158751375 18:60265250-60265272 TGGCAGGAATGATAGGGATGGGG + Intergenic
1158866119 18:61639055-61639077 TTGTGGGAAGGGGAGGAAAGGGG + Intergenic
1159610009 18:70514379-70514401 TTGTGGGAATTGTTGAGAAGTGG + Intergenic
1159660485 18:71090056-71090078 TTGTATGAGGGGTAAGGAAGGGG + Intergenic
1161810399 19:6468038-6468060 TTGCAGGGATGGCAGGGAAAGGG + Exonic
1162000481 19:7741881-7741903 TTGTAGGAATGGTCTGGACTAGG - Exonic
1162164619 19:8743844-8743866 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162165691 19:8751312-8751334 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162166756 19:8758768-8758790 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162167822 19:8766228-8766250 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162168761 19:8772522-8772544 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162170507 19:8785290-8785312 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162181669 19:8873404-8873426 TGGTGGGAATGGTAGAGGAGTGG + Intronic
1162788561 19:13051376-13051398 TACTAGGGATGGAAGGGAAGAGG + Intronic
1164663444 19:30001489-30001511 TTGTAGAGATGGTAGGGAATAGG - Intronic
1166008691 19:39925490-39925512 CTGGAGGGAAGGTAGGGAAGAGG - Intronic
1166263992 19:41665590-41665612 TTGGAGGAAAGGGTGGGAAGGGG + Intronic
1166730230 19:45055132-45055154 GTGTGGCAATGGTAGGGGAGAGG + Intronic
1166874125 19:45886842-45886864 TTTTGGGAATTGTAGTGAAGCGG - Intergenic
1167304212 19:48697496-48697518 TTGTAGGGATGGTGGGGAGGGGG - Intronic
925431053 2:3793577-3793599 TTGTATGAATGGAGGGGAAATGG + Intronic
927151493 2:20198863-20198885 TTGTAGGATGGGTGGGGAGGAGG - Intergenic
928011463 2:27611868-27611890 TTGTAGTTATGGTAGAGACGGGG + Intronic
928723818 2:34148513-34148535 ATGTAGCAAAGGTAGGAAAGTGG + Intergenic
929067316 2:37991086-37991108 TTGTATTAATGATAGGGATGGGG + Intronic
929440282 2:41960824-41960846 TTCTAGAAATGGCTGGGAAGGGG + Intergenic
930321449 2:49859275-49859297 TAGAAGGAATGGTAAGGCAGTGG + Intergenic
934899453 2:98146352-98146374 GGGGAGGAAAGGTAGGGAAGGGG + Intronic
935029856 2:99311467-99311489 TTGTAGAGATGGTGGGGGAGGGG + Intronic
936235571 2:110739728-110739750 TTGTATAAATGCTTGGGAAGTGG - Intronic
937015645 2:118602910-118602932 TTGTAGGAAACATAGAGAAGTGG + Intergenic
937841753 2:126531649-126531671 GTGTAGGATAGGTAGGGAAAAGG - Intergenic
938894626 2:135737950-135737972 TTGTAGGAAGGGTAGGGGGGTGG - Intergenic
942162471 2:173206004-173206026 TAGTAAGAAGGGTAGGGAAGGGG - Intronic
942644101 2:178092304-178092326 TTGTTGGCATGCTAAGGAAGGGG - Intronic
943090437 2:183367813-183367835 TTGTAGAAGGGGTAAGGAAGGGG + Intergenic
943115786 2:183668313-183668335 TGGCAGGGAGGGTAGGGAAGCGG + Intergenic
943211326 2:184971192-184971214 TTGTAAAAATGGGAGTGAAGAGG + Intergenic
943787464 2:191894107-191894129 TTGTAGGAAATATAGGAAAGGGG + Intergenic
944121810 2:196248542-196248564 CTGTAGGAAAGGTGGGGAAAGGG + Intronic
945754034 2:213824085-213824107 TTGTATGAAGTGTAAGGAAGGGG + Intronic
946077122 2:217083533-217083555 TGTTAGGTATGGTAGGGCAGGGG + Intergenic
946803326 2:223444324-223444346 GTGGAGGAATGGTAGGCATGAGG - Intergenic
948011622 2:234653544-234653566 TTGTATTTTTGGTAGGGAAGGGG + Intergenic
1169131236 20:3167279-3167301 TTGTACCCATTGTAGGGAAGGGG - Intronic
1170333883 20:15247249-15247271 TTGTAGGAATGAAATAGAAGTGG + Intronic
1170557159 20:17524018-17524040 TTGTAGGCATGGAAGGGGCGGGG + Intronic
1172709735 20:36912272-36912294 TTGGAGGAAAAGGAGGGAAGTGG - Intronic
1172716736 20:36969905-36969927 TTGTGGGAGTGGTAGGGTAAAGG - Intergenic
1173541828 20:43859017-43859039 TTGAAGGAAGGGTAAAGAAGAGG - Intergenic
1175341346 20:58232151-58232173 TTGTAGGTAGGGTGGGGCAGGGG + Intergenic
1175384104 20:58583240-58583262 GTGTAGAAATGTTTGGGAAGGGG + Intergenic
1176273470 20:64248527-64248549 TTGGAAGAGTGGCAGGGAAGGGG + Intergenic
1176655429 21:9584942-9584964 TAGTAAGAATGGTAAGGAATTGG + Intergenic
1177260971 21:18729357-18729379 GTGTAGAAAGGGTGGGGAAGTGG + Intergenic
1177373371 21:20236097-20236119 TTGTATGAAGTGTAAGGAAGAGG + Intergenic
1177387910 21:20431116-20431138 TTGTAGGTTTTGTAGAGAAGGGG - Intergenic
1183111338 22:35651011-35651033 TTTTAGAAGTGGAAGGGAAGAGG + Intronic
1183140471 22:35933557-35933579 TTGGGGGATGGGTAGGGAAGAGG - Intronic
1183145098 22:35982978-35983000 TTGTAGGGGAGGAAGGGAAGAGG - Intronic
1185415926 22:50710255-50710277 TTGGAGGAAGGGGAGGGAAGGGG + Intergenic
951342442 3:21505034-21505056 TTCCAGGAATGGGAGGGAAGTGG + Intronic
952496366 3:33919382-33919404 TTGGAGGAATGGGATGGAGGAGG + Intergenic
954242004 3:49301110-49301132 TTTTAGGTTTGGTAGGGATGGGG + Intronic
955450297 3:59058982-59059004 TTGTAGGAAAGGGTGTGAAGGGG - Intergenic
956095400 3:65710881-65710903 TTGGAGAAATGGTAGGAAAGTGG - Intronic
956878601 3:73488556-73488578 TTGTAGAGATGGTAGGCAGGTGG - Intronic
959358358 3:105360065-105360087 TTGTAGGAACTGTAGGAACGAGG + Intergenic
959591375 3:108085557-108085579 ATTGAGTAATGGTAGGGAAGGGG - Intronic
959658755 3:108841681-108841703 TTGCAGGAAGGGCAGGGAATGGG - Intronic
961746263 3:129065237-129065259 TTGTAGCTTTTGTAGGGAAGGGG + Intergenic
963459515 3:145591066-145591088 TGGCAGGAATGGGAAGGAAGGGG + Intergenic
963686454 3:148440913-148440935 TAGTGGAAATGGTTGGGAAGAGG - Intergenic
964327414 3:155562399-155562421 TTCTAGGAAAGGAAGCGAAGTGG - Intronic
965388979 3:168081392-168081414 TAGTAGGCAGGGTTGGGAAGGGG + Intronic
965613154 3:170565790-170565812 TTCTAGTAATAGCAGGGAAGGGG - Intronic
966732369 3:183161920-183161942 TGCTAGGAATGTTAGGGAAGAGG - Intronic
967419129 3:189254193-189254215 TTGTATGAAGTGTAAGGAAGGGG + Intronic
968941427 4:3640700-3640722 GTGGAGGAATGGGAGGGAAGAGG + Intergenic
969125507 4:4945126-4945148 TTATTGGAATGGTAGGGAAGGGG + Intergenic
971086371 4:23280613-23280635 TTTTAGGAATGGTAGTGTAGAGG + Intergenic
971540366 4:27808565-27808587 TTGTAGGATTGGGATGGAGGGGG - Intergenic
972894119 4:43597935-43597957 TTGTAGTAATGGCAAAGAAGAGG - Intergenic
973400579 4:49634879-49634901 TTGGTGGAATGGTATGGAATGGG + Intergenic
973401777 4:49642250-49642272 TTGATGGAATGGTATGGAATGGG + Intergenic
976113369 4:81700666-81700688 TTGTATAAATGCTAGGGATGAGG + Intronic
976986871 4:91311980-91312002 TTGTAGGAATGAAAGTGAGGAGG + Intronic
977222677 4:94356374-94356396 CTGTAGGCATGTTATGGAAGAGG - Intergenic
978387956 4:108194826-108194848 TTGTGGGAGTGGGAGGGCAGGGG - Intergenic
979129848 4:117030012-117030034 CTGTATGTATGGTAGGGAAGTGG - Intergenic
979920023 4:126484846-126484868 GTGTAGGAATGGTGGTAAAGAGG - Intergenic
979989800 4:127362350-127362372 TTTTAGTAATGATAGGGAACTGG - Intergenic
983722137 4:170868680-170868702 CTGGAGGAATTTTAGGGAAGTGG - Intergenic
983819929 4:172180621-172180643 TTGTAGAAAGTGTAAGGAAGCGG + Intronic
983982454 4:174015469-174015491 TTCCAGGAAAAGTAGGGAAGTGG + Intergenic
984067927 4:175072701-175072723 TTGTAGGCATGATTGGGTAGGGG + Intergenic
984267132 4:177508570-177508592 TTGAAGGAATGCTAGAGGAGCGG - Intergenic
987916729 5:24224986-24225008 TTGTAGGGCTGGTCTGGAAGTGG + Intergenic
988288176 5:29249332-29249354 TTGTAGGAATGATAAGGCTGTGG + Intergenic
988457365 5:31398286-31398308 TTGGAGGAATGGAAGAGAATTGG - Intergenic
988800399 5:34691133-34691155 TTGGAAGGATGGTTGGGAAGAGG + Intronic
989704503 5:44312458-44312480 TTGTAGGAATGGGAAAGAGGAGG - Intronic
990961560 5:61398861-61398883 ATGGCGGAATGGTAGGGCAGGGG + Intronic
992294070 5:75309600-75309622 TTGTGGGAGTGGGAGGCAAGGGG + Intergenic
995130846 5:108629048-108629070 TTGTTGGAATGAGAGGGTAGAGG + Intergenic
995442562 5:112208071-112208093 TTGTAGGTTTGGTAGAGATGGGG - Intronic
995458705 5:112379479-112379501 TTGAAGAAATGACAGGGAAGAGG + Intronic
995711862 5:115043905-115043927 TTGTATAAATTGTAAGGAAGAGG - Intergenic
995847343 5:116508522-116508544 TTGGAGGAATAGTTGGGCAGAGG - Intronic
995984616 5:118154578-118154600 TTGTAGGGATGGGAGATAAGGGG - Intergenic
998883396 5:146668432-146668454 TTCTAAGATTGGCAGGGAAGTGG - Intronic
999029605 5:148276470-148276492 TTGTGTGAATTGTAAGGAAGGGG + Intronic
1000397082 5:160787385-160787407 TTGTAGGAAGGTTAGGGCAGGGG - Intronic
1000836576 5:166161922-166161944 TTATGGGAATGGTAGGGGAAAGG + Intergenic
1000983641 5:167843554-167843576 TTGTAGGGTTGGTGGGGGAGGGG + Intronic
1002991220 6:2240854-2240876 TTGTAGAATTGGTAGAGAAAAGG + Intronic
1004750435 6:18556993-18557015 TGGTAGGCATGGTAGAGGAGTGG - Intergenic
1004801081 6:19148951-19148973 TTGTTGCAATGGTGGGGTAGGGG - Intergenic
1005757255 6:28936101-28936123 TTGTAGAGATGGTGGGGCAGGGG + Intergenic
1006646138 6:35515577-35515599 TTGTAGTTTTGGTAGGGATGGGG + Intergenic
1007206728 6:40158622-40158644 GGGTAGGAATGGTAGGGAAAGGG - Intergenic
1007941224 6:45783228-45783250 TTTTAGAAATGGTAGGGCGGGGG - Intergenic
1007974489 6:46086524-46086546 TTGTGGGAAAAGTAGAGAAGAGG + Intergenic
1009783542 6:68300809-68300831 TTGTATGAAGTGTAAGGAAGGGG + Intergenic
1010915295 6:81609464-81609486 TTCTGGGAATGGCAGGGGAGGGG + Intronic
1011393446 6:86879726-86879748 TGCTAGGAAAGGTTGGGAAGAGG + Intergenic
1012593883 6:101017721-101017743 TTTTAGGAATGGTAACGAAGAGG - Intergenic
1012604066 6:101134867-101134889 TAGTAGGAATGGTAGGAATAAGG - Intergenic
1012917584 6:105187154-105187176 TTGCAGGAAGAGTAAGGAAGTGG - Intergenic
1013392144 6:109696729-109696751 GGGTAGGAAGGGTAGGAAAGAGG + Intronic
1013908607 6:115246996-115247018 TTGTGGAAAGGGGAGGGAAGAGG + Intergenic
1014111218 6:117620212-117620234 TTGTACGCATGGTAGGCCAGAGG + Intergenic
1015282890 6:131452773-131452795 TTTGGGGAATAGTAGGGAAGTGG + Intergenic
1015359633 6:132323984-132324006 CTGGAGGGATGGTATGGAAGAGG + Exonic
1015566123 6:134573638-134573660 GTGTAGGATGGGTAGAGAAGGGG - Intergenic
1016399765 6:143667050-143667072 TTGTATGAAGTGTAAGGAAGGGG + Intronic
1016850225 6:148611644-148611666 TTGCAGGAGTGGTTGGGAGGTGG - Intergenic
1016861238 6:148720896-148720918 TTATAGGAAAGGCAGGGGAGGGG - Intergenic
1019776302 7:2913753-2913775 TTGGAGGAAGGGTAGGGACTGGG + Intronic
1019784364 7:2965559-2965581 TTGTAGGAATGAAGGGGATGGGG - Intronic
1021135020 7:16954983-16955005 TTGTAGAAGTGGATGGGAAGAGG - Intergenic
1021526571 7:21594975-21594997 CTGTAGGGAGGCTAGGGAAGAGG + Intronic
1021560157 7:21961570-21961592 TTGTATTATTGGTAGAGAAGGGG + Intergenic
1022332283 7:29391318-29391340 AGGTAGGAAGGGAAGGGAAGAGG + Intronic
1022453436 7:30536879-30536901 TTGGAGGAATGGGAGAGAATTGG + Intronic
1022966861 7:35482257-35482279 TTGTAGGAATGAAACGGAACAGG + Intergenic
1024006707 7:45229660-45229682 TTGCAGGATTGGTAGGTATGGGG - Intergenic
1024125460 7:46290372-46290394 TTGTACCAATGGCAGGGCAGTGG - Intergenic
1024848892 7:53685656-53685678 TTGGAGGAATTGTCTGGAAGTGG + Intergenic
1025887227 7:65607898-65607920 ATGAAGGAATGGTACAGAAGAGG - Intergenic
1026420612 7:70233220-70233242 TGGTAGGGAGGGTAGGAAAGTGG - Intronic
1027872994 7:83733048-83733070 TTGGAGGAAGGTTAGGTAAGGGG - Intergenic
1028427656 7:90708043-90708065 TTGTACGAATGTTAGGGGAAAGG + Intronic
1030171525 7:106607541-106607563 GTGAATGAATGGTAGGGGAGAGG + Intergenic
1031562860 7:123259109-123259131 TTGTAAGACTGGTAGATAAGAGG - Intergenic
1031855183 7:126914035-126914057 ATGAAGGAATGGTACAGAAGAGG + Intronic
1033287087 7:140050474-140050496 TTCTAGTGATGGTGGGGAAGAGG - Intronic
1033721078 7:144060131-144060153 TTTTAGCCATGGTTGGGAAGTGG - Intergenic
1038291134 8:26250909-26250931 TTGGGGGAAGGGTAGGGAATGGG + Intergenic
1039929282 8:41969503-41969525 TGGTAGAAATGGGAGAGAAGTGG - Intronic
1040739821 8:50559694-50559716 TTGTATAAAGGGTAAGGAAGTGG - Intronic
1041180229 8:55239661-55239683 TTGTAGAAATGGGAGTGAATGGG - Intronic
1041656966 8:60362059-60362081 TTTTAGCAATGGTAGGGCACTGG + Intergenic
1042379841 8:68100827-68100849 TTGTAGGAATGGATTGCAAGGGG + Intronic
1042960493 8:74298738-74298760 TTGTAGGAAAGTTAGGAAAGTGG - Intronic
1043051798 8:75394225-75394247 TTGAATGAATGGTGGAGAAGAGG - Intergenic
1043932808 8:86110014-86110036 TTAAAGGAGTGGTAGAGAAGGGG - Intronic
1046078116 8:109336369-109336391 TTGCAGGACTTGGAGGGAAGTGG + Intronic
1046763209 8:118042626-118042648 TTGTAGGAATGGCAGGGCAAAGG - Intronic
1048419062 8:134259168-134259190 TTTTAGGAATGTGGGGGAAGGGG - Intergenic
1049525999 8:143127310-143127332 TTGGAGGAGTGGTAGGGGATGGG + Intergenic
1050280310 9:4043500-4043522 CTGTAGGAAGGGCTGGGAAGGGG + Intronic
1050603250 9:7273818-7273840 TTGCAGGAACGCTAGGGAAGTGG - Intergenic
1051862916 9:21646977-21646999 TTGTATGAAGTGTAAGGAAGGGG + Intergenic
1052045885 9:23793571-23793593 TTGGAGGAATGATAGGGGAGGGG - Intronic
1053255306 9:36612266-36612288 TTGTAGTTTTAGTAGGGAAGGGG + Intronic
1054822936 9:69542170-69542192 GTGTATGCAGGGTAGGGAAGAGG - Intronic
1055429489 9:76229236-76229258 TTGTTGGTATGGTGGGGAATTGG - Intronic
1058227219 9:102380270-102380292 TTGTAGAAAGTGTAAGGAAGTGG + Intergenic
1058322329 9:103649154-103649176 TTGTGGGAATGGCAGGTGAGAGG + Intergenic
1060401005 9:123349628-123349650 TTGTAGGAAGGCTCAGGAAGGGG + Intergenic
1203633147 Un_KI270750v1:88414-88436 TAGTAAGAATGGTAAGGAATTGG + Intergenic
1185756944 X:2659788-2659810 GAGGAGGAATGGGAGGGAAGGGG - Intergenic
1186188621 X:7046140-7046162 GTGTAGGAATTGGAGGGAGGTGG - Intergenic
1186772811 X:12834198-12834220 TTGTATAAGTTGTAGGGAAGGGG + Intergenic
1186910261 X:14156608-14156630 TTGTATGAAGTGTAAGGAAGGGG + Intergenic
1187217956 X:17295398-17295420 CTGTAGGAGTTCTAGGGAAGGGG + Intergenic
1188263065 X:28040343-28040365 AGGGAGGTATGGTAGGGAAGTGG + Intergenic
1188931486 X:36116883-36116905 GTGGAGGAGTGGGAGGGAAGTGG - Intronic
1192699990 X:73458665-73458687 TTGTATGAGTGGTGGGGAAGTGG - Intergenic
1193162870 X:78247385-78247407 TTGTAGAAATGGTAGAAAGGAGG + Intergenic
1193335099 X:80278707-80278729 TTGTATAAATTGTAAGGAAGGGG - Intergenic
1194062288 X:89218536-89218558 TTGGAGGATTGCTAGGGATGAGG - Intergenic
1197339023 X:125243468-125243490 TTGTAGTTTTGGTAGAGAAGGGG - Intergenic
1198545175 X:137684751-137684773 TTGTTGGAAGGGTAGAGAGGAGG + Intergenic
1198642879 X:138776127-138776149 TGGTAGAAATAGTAGGGATGGGG - Intronic
1199480407 X:148292243-148292265 TGAAAGGAATGGTAGGGAAGTGG - Intergenic
1200716154 Y:6547502-6547524 TTGGAGGATTGCTAGGGATGAGG - Intergenic