ID: 1115592041

View in Genome Browser
Species Human (GRCh38)
Location 14:34874317-34874339
Sequence CCTCCACCTGGAGAACGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115592041_1115592052 6 Left 1115592041 14:34874317-34874339 CCCGCGCGTTCTCCAGGTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1115592052 14:34874346-34874368 GGCAGAGAACCGCGGGCCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 136
1115592041_1115592050 4 Left 1115592041 14:34874317-34874339 CCCGCGCGTTCTCCAGGTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1115592050 14:34874344-34874366 GAGGCAGAGAACCGCGGGCCCGG 0: 1
1: 0
2: 1
3: 21
4: 206
1115592041_1115592048 -1 Left 1115592041 14:34874317-34874339 CCCGCGCGTTCTCCAGGTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1115592048 14:34874339-34874361 GCCAGGAGGCAGAGAACCGCGGG 0: 1
1: 0
2: 2
3: 42
4: 402
1115592041_1115592047 -2 Left 1115592041 14:34874317-34874339 CCCGCGCGTTCTCCAGGTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1115592047 14:34874338-34874360 GGCCAGGAGGCAGAGAACCGCGG 0: 1
1: 0
2: 2
3: 43
4: 433
1115592041_1115592053 7 Left 1115592041 14:34874317-34874339 CCCGCGCGTTCTCCAGGTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1115592053 14:34874347-34874369 GCAGAGAACCGCGGGCCCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 141
1115592041_1115592051 5 Left 1115592041 14:34874317-34874339 CCCGCGCGTTCTCCAGGTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1115592051 14:34874345-34874367 AGGCAGAGAACCGCGGGCCCGGG 0: 1
1: 0
2: 0
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115592041 Original CRISPR CCTCCACCTGGAGAACGCGC GGG (reversed) Intronic
900495481 1:2974150-2974172 CGTCCACCTGGAGAAGGCACAGG - Intergenic
904326317 1:29728959-29728981 CCTCCACCTGCAGGCCGCTCTGG + Intergenic
904534211 1:31188454-31188476 TCTCCACATGGAGAAGGTGCAGG - Intronic
905259001 1:36704466-36704488 CCTTCACCTGGAGAGTGCTCCGG - Intergenic
906112132 1:43331124-43331146 CCTCCTCCTGGGGTAGGCGCTGG - Intergenic
915168917 1:153964128-153964150 CACCCACCTGGAGAAGGCGGAGG - Intronic
917972799 1:180219535-180219557 CCTCCTCCTGGGGAACGCCCTGG + Intergenic
921177320 1:212606852-212606874 CCTCCCGCTGGAGTGCGCGCAGG - Intronic
922873527 1:228921721-228921743 CCTCAACCTTGAGAACACTCAGG - Intergenic
1068844688 10:61658766-61658788 CCTCCAGCTGGAGAAAACGGTGG + Intergenic
1070192553 10:74125466-74125488 CCTCCTCCTGGAGACCACACAGG - Intronic
1073289228 10:102405176-102405198 CCTCTACCTGCAGAAGGTGCGGG - Exonic
1073326155 10:102644857-102644879 CCTGCACGTGGAGAAGCCGCCGG + Exonic
1075032070 10:119030161-119030183 CCGCTACCTGGGGAGCGCGCTGG + Exonic
1075617594 10:123902979-123903001 CCACCACCTGGAGTACCCTCTGG + Intronic
1076401080 10:130185770-130185792 CGTCCACCTGGAGTGCGGGCTGG + Intergenic
1079141347 11:17812060-17812082 CCTCCATCTGCAGAAGGGGCAGG + Intronic
1083356432 11:62069626-62069648 CCTCCACCTCCAGAACTCGTCGG - Intergenic
1084206014 11:67593432-67593454 CATCCACCTGCAGAACGAGGCGG - Intergenic
1084308906 11:68304583-68304605 CCTGCACCTGGAAAAGCCGCAGG + Intergenic
1085600818 11:77854689-77854711 CATGCACCTGGAAAACCCGCAGG - Intronic
1091348675 11:134874822-134874844 GCTCCACCTGCAGAAAGAGCTGG - Intergenic
1091385537 12:92346-92368 CCTCCAGCCGCAGAACTCGCAGG + Intronic
1101879382 12:108616222-108616244 CCTCCACCTGGAGGTTGAGCAGG + Intergenic
1101961261 12:109252093-109252115 TCTCCACCTGGATCACTCGCTGG - Exonic
1104448867 12:128853638-128853660 CCTGCACCTACCGAACGCGCTGG - Exonic
1105481720 13:20784432-20784454 GCTCCACTTGGAGAAGGCACTGG - Intronic
1107768632 13:43765408-43765430 CCTCCACCTGGAGAGCCCCTTGG + Intronic
1115592041 14:34874317-34874339 CCTCCACCTGGAGAACGCGCGGG - Intronic
1120800463 14:88682753-88682775 CCTCCATCTGGAGGAGGGGCTGG - Intronic
1122037654 14:98960468-98960490 CCACCACCTGGAGCAGGCCCAGG + Intergenic
1122337950 14:101006205-101006227 CCTCCAGCCAGAGACCGCGCTGG + Intergenic
1124530829 15:30504168-30504190 CCTTCCCCTGGAGAAGGCTCTGG - Intergenic
1124767831 15:32503527-32503549 CCTTCCCCTGGAGAAGGCTCTGG + Intergenic
1128267403 15:66278861-66278883 CCACCAGCTGGAGAAGGCGTGGG + Intergenic
1131418316 15:92280252-92280274 CCTCCACATGGAGAATCAGCAGG + Intergenic
1133334319 16:4996899-4996921 CTTCCACCTGGACAAGGCCCGGG + Exonic
1136618725 16:31413831-31413853 CAGCCACCTGGAGAATGAGCAGG - Intronic
1136642420 16:31578038-31578060 CCTGCACCTGGAAAAACCGCAGG + Intergenic
1140035020 16:71365126-71365148 CCTCCATCTGGAGCACCCTCTGG - Intronic
1141420961 16:83915270-83915292 CTTCCACCTGCAGAACGGGGCGG + Exonic
1141625321 16:85258542-85258564 CCTCCACCTGGAGGGCAGGCGGG - Intergenic
1142231018 16:88900361-88900383 CCTCCATCTGGAGAGAGCACTGG - Intronic
1142848283 17:2692410-2692432 GCGCTTCCTGGAGAACGCGCTGG - Exonic
1148597959 17:48871983-48872005 CCTCAAGCTGGAGAAAGCCCTGG - Intergenic
1154306712 18:13235849-13235871 CCTCCACCCGGAGAACAGACTGG + Intronic
1160508026 18:79438050-79438072 CCCCCAGATGGAGAACACGCAGG - Intronic
1160655671 19:267510-267532 GCCCAACCTGGAGCACGCGCGGG - Intergenic
1162562663 19:11426541-11426563 CCTCAACTTGGAGAACCGGCTGG - Exonic
1164467864 19:28503257-28503279 GCTCCTCCTGGAGAACACGTGGG - Intergenic
1164682443 19:30144852-30144874 CCTCCACCTGGGAAGCACGCGGG + Intergenic
1165822664 19:38686441-38686463 CCTTCACCTGGAGAACAGGGAGG - Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1168412181 19:56146986-56147008 CTTCCACCTGGGCGACGCGCCGG + Exonic
927931903 2:27050695-27050717 CCTTCAGCTGGAGAAAGCGGGGG + Intronic
933611955 2:84445486-84445508 CCTCCACTTTGAGAACTAGCAGG + Intronic
937362449 2:121238444-121238466 CGTCCACCTGGAGAGCGCTCAGG - Intronic
940118320 2:150235163-150235185 CTTCCACCTGGAGAACTGGGTGG + Intergenic
943832366 2:192478839-192478861 CCTACACCTGGAAAACCTGCAGG + Intergenic
948355934 2:237377081-237377103 CCTCAACCTGGGCTACGCGCTGG - Exonic
948808290 2:240462333-240462355 CCTGCACCTGGAGGAGACGCTGG + Exonic
949001771 2:241618889-241618911 CCTTTGCCTGGAGAACGCTCTGG - Intronic
949022842 2:241751313-241751335 CCACTTCCTGGAGCACGCGCTGG + Exonic
1170585865 20:17733295-17733317 CCTCCACCTGGGGAATGGGAGGG + Intronic
1173209564 20:41021642-41021664 CCTCCAGCTAGAGAACCAGCAGG - Intergenic
1174290347 20:49504061-49504083 TCTCCATCTGGAGAACAGGCAGG + Exonic
1174737954 20:52983848-52983870 GCACCACTTGGAGAGCGCGCAGG - Intronic
1175859596 20:62143234-62143256 CTTCCAAGTGGAGTACGCGCAGG - Exonic
1175962316 20:62643219-62643241 CCTGCACCTGGAGGGCGCCCGGG - Exonic
1178535035 21:33403790-33403812 CCCCCACCTGGGGCACCCGCAGG - Intronic
1179517919 21:41922079-41922101 CCACCACCTGGAGGAGGCACAGG + Exonic
1180199393 21:46215517-46215539 CCTCCACCCTGAGAACCAGCTGG - Intronic
1180782795 22:18530087-18530109 CCTCCTCCTGGAAACCGGGCCGG + Intronic
1181126357 22:20704119-20704141 CCTCCTCCTGGAAACCGGGCCGG + Intergenic
1181239685 22:21469425-21469447 CCTCCTCCTGGAAACCGGGCCGG + Intergenic
1183072113 22:35403398-35403420 CCTCCAGCTGGAGAAAGGGAAGG - Exonic
1184800439 22:46755678-46755700 CCTACACCTGGAGAAGCTGCAGG - Intergenic
953212915 3:40892163-40892185 CCTCCACCTGGAGAATTACCAGG + Intergenic
956750920 3:72343214-72343236 CCTCCACCAGGAGAAGGCAGAGG - Intergenic
957490629 3:80921921-80921943 CCTGCACCTGGAAAAGCCGCAGG + Intergenic
963091347 3:141486775-141486797 TCCCCACCAGGAGAACGCCCCGG - Intergenic
966400989 3:179546731-179546753 CCTCCACCTGGGGAAAGGGGAGG + Intergenic
968515075 4:1012338-1012360 CCTCCGCCTGGAGCGCGGGCGGG + Intronic
980514094 4:133831150-133831172 CCTCCACCTGGAGTAGGCCCCGG - Intergenic
981416406 4:144498834-144498856 CCTCAACCTGGAGACCGAGGAGG - Intergenic
982380221 4:154741871-154741893 CCTCCACCTGGGGAACTTGAGGG - Intronic
985630053 5:1009365-1009387 CCATCGCCTGGAGACCGCGCAGG - Intronic
985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG + Intergenic
998452345 5:142244738-142244760 CCTCCACCTGGAAAATGGGATGG - Intergenic
999092456 5:148948551-148948573 TCTCCATCTGGAGAACAGGCAGG - Intronic
1000763030 5:165250487-165250509 CCTACATCTGGAGAAGGTGCAGG - Intergenic
1002084890 5:176768307-176768329 ACTCCCCCTGGAGAATGAGCTGG - Intergenic
1002569891 5:180134326-180134348 TATCCACCTGGAGAACGCACAGG - Intronic
1019206087 6:170363133-170363155 CCTCCACCTGGAGAGCGGGCTGG - Intronic
1022977812 7:35575017-35575039 CCTCCACCTGCAGATCTAGCAGG + Intergenic
1023512902 7:40971995-40972017 CCACCACCTAGAGAAAGCTCTGG + Intergenic
1026955320 7:74372979-74373001 CCTGCTACTGGAGAAGGCGCAGG + Exonic
1027266943 7:76499667-76499689 CCACTACCTAGAGAACGCCCCGG + Intronic
1027318758 7:76999535-76999557 CCACTACCTAGAGAACGCCCCGG + Intergenic
1032464407 7:132134813-132134835 CCTCCACCTTCAGAACCCTCAGG + Intronic
1034160964 7:148994013-148994035 CATCCACCTGGAGAGTGAGCTGG + Intergenic
1037547574 8:19939551-19939573 CCTCCACCTGCAGACCCGGCGGG + Intronic
1038178020 8:25198905-25198927 CCTCCACCTGGAAAAAACCCAGG - Intronic
1043002103 8:74771908-74771930 CATCCACCTGGAGCCCGCACTGG + Intronic
1044511229 8:93081619-93081641 CTTCAACCTGGAGAATGCACTGG + Intergenic
1046108149 8:109691354-109691376 CCTCCTCCTGGACAGCGCGATGG - Exonic
1058585395 9:106501606-106501628 CGCCCACCTGGAAATCGCGCTGG + Intergenic
1061431806 9:130535994-130536016 CCTCCACTTGGAGGACGGGATGG + Intergenic
1061844920 9:133382120-133382142 CCTCCACCCGGAGAGGGCACAGG + Intronic
1192034311 X:67546304-67546326 CATCAAGCTGGAGAACCCGCTGG + Exonic
1192054299 X:67757814-67757836 TCTCCACCTGGAGAGCCCACAGG - Intergenic
1192344630 X:70290675-70290697 CCACCACCTAGAGAAGGCACGGG - Exonic
1192640818 X:72860075-72860097 CCAGCACCTGGAGAACGTGCTGG - Intergenic
1192640893 X:72860701-72860723 CCAGCACCTGGAGAACGTGCTGG + Intergenic