ID: 1115602148

View in Genome Browser
Species Human (GRCh38)
Location 14:34965719-34965741
Sequence GGGTATAAGTAATTGCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115602145_1115602148 13 Left 1115602145 14:34965683-34965705 CCAGAGAATTAGAAGAGTGAACA No data
Right 1115602148 14:34965719-34965741 GGGTATAAGTAATTGCATTCTGG No data
1115602144_1115602148 14 Left 1115602144 14:34965682-34965704 CCCAGAGAATTAGAAGAGTGAAC No data
Right 1115602148 14:34965719-34965741 GGGTATAAGTAATTGCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115602148 Original CRISPR GGGTATAAGTAATTGCATTC TGG Intergenic
No off target data available for this crispr