ID: 1115610783

View in Genome Browser
Species Human (GRCh38)
Location 14:35046704-35046726
Sequence TGCTCGGAGGACGGCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115610783_1115610788 -6 Left 1115610783 14:35046704-35046726 CCTGCGCGGCCGTCCTCCGAGCA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1115610788 14:35046721-35046743 CGAGCAGGCCGCCCCAGCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115610783 Original CRISPR TGCTCGGAGGACGGCCGCGC AGG (reversed) Intronic
901835802 1:11923261-11923283 TGGACGGAGGACAGCCGCCCCGG + Exonic
915305464 1:154974697-154974719 TGCTTGGAGGTTGGCGGCGCGGG + Exonic
919705224 1:200669652-200669674 GGATGGGAGGAAGGCCGCGCAGG + Intronic
924383668 1:243484220-243484242 TGCTCAGAGGAAGGCGACGCTGG - Intronic
1069984325 10:72273439-72273461 TGCCCGTGGGACGGCGGCGCAGG - Intergenic
1077303849 11:1859084-1859106 TGCTTGGAGCAGGGCCGCTCTGG + Intronic
1077363646 11:2152445-2152467 TGCTTGGAGGACGGATGGGCAGG + Intronic
1078086754 11:8238382-8238404 TGCTTGGAGGATGGGCGCGGTGG + Intronic
1083579118 11:63813641-63813663 TGGCCGGAGGACTGGCGCGCAGG - Exonic
1086112011 11:83209350-83209372 TGCTTGGAGGTTGGCAGCGCGGG + Intronic
1088658622 11:112025529-112025551 GGCTCGGTGGACGGCCTTGCAGG + Exonic
1096811541 12:54173549-54173571 GGCTCGGCGGCGGGCCGCGCGGG - Intronic
1102740631 12:115204457-115204479 TGCTGGGAGGAGGGCCAGGCAGG - Intergenic
1112270531 13:97964734-97964756 TGCTGGGAGGCCGGGCGCGGTGG - Intronic
1115610783 14:35046704-35046726 TGCTCGGAGGACGGCCGCGCAGG - Intronic
1122542732 14:102507116-102507138 TGCTGGGCGACCGGCCGCGCTGG - Exonic
1123044625 14:105505302-105505324 TCCTCCGAGGACGGCCTCACTGG + Intergenic
1124831375 15:33153139-33153161 TGCTCTGAGGAAGGCCGGGCTGG + Exonic
1129589773 15:76905076-76905098 GGCTCGGAGGTCGGCCTCGGAGG - Intronic
1129925169 15:79357620-79357642 TACTGGGAGGACTGCCGTGCTGG + Intronic
1132398463 15:101490303-101490325 TGCTGGGAGGCAGGCCGTGCAGG + Intronic
1133346150 16:5071905-5071927 TGCTGGGAGGATGGAAGCGCTGG + Exonic
1139451311 16:67029657-67029679 CGCTGGGAGGGCGGGCGCGCGGG + Intronic
1143258798 17:5583575-5583597 TGCTCAGAGGAAGGCCTGGCAGG + Intronic
1151812491 17:76452819-76452841 TGCTCCGAGGCCGGGGGCGCGGG - Exonic
1152617707 17:81345623-81345645 CGCTCCGAGGGCGGCCTCGCGGG + Intergenic
1152638572 17:81440151-81440173 TGCCCAGAGGACAGCCCCGCAGG + Intronic
1152714325 17:81891297-81891319 AGTGCGGAGGCCGGCCGCGCCGG - Intronic
1157491179 18:48124871-48124893 TGCTCTGAGGACAGCAGCGGTGG + Intronic
925971674 2:9110669-9110691 TGGTCTGAGGACGGCAGCTCAGG - Intergenic
939568501 2:143813053-143813075 TGCATGGAGGCCGGCCGCGGTGG + Intergenic
942063218 2:172247252-172247274 TGCTCAGAGGACGTCAGCCCTGG - Intergenic
947933370 2:233982972-233982994 TCCACTGAGGACGGCCGGGCCGG + Intronic
1172772722 20:37391077-37391099 TGCTCGGAGGCCAGCCAAGCAGG - Intronic
1172978739 20:38925712-38925734 TGCTAGGAGGCCGGGCGCGGTGG - Intergenic
1175855491 20:62118750-62118772 TGCTAGGAGGACTTCCGGGCAGG - Intergenic
1179992992 21:44958322-44958344 AGCTTGGAGGAGGGCCGGGCTGG - Intronic
1180038895 21:45265751-45265773 TGCTCGGGGGACGGCCGTGTTGG - Intronic
1185085772 22:48740254-48740276 GGCTGGGAGGACGGCAGGGCAGG + Intronic
1185318468 22:50189411-50189433 TGCTCGGTGGACGTCCGTGCGGG + Intronic
954113028 3:48446484-48446506 TCCGTGGAGGAGGGCCGCGCAGG - Intergenic
957947987 3:87089096-87089118 TGCCCGGAGTACGGGGGCGCGGG + Intergenic
958814582 3:98901581-98901603 GCCGCGGAGGACGGCCGCGGCGG + Exonic
968829559 4:2925908-2925930 TTCTCAGAGGGCGGCCGAGCGGG + Intronic
973893980 4:55394574-55394596 TGGACGGAGGCCGGCCGCGGTGG + Intergenic
974260460 4:59518681-59518703 TGCACCGAGGACTGCCGCGATGG - Intergenic
978384399 4:108166588-108166610 AGCGCGGAGCAGGGCCGCGCTGG - Intronic
984608555 4:181812667-181812689 GGCTCGGAGGACAGCTGAGCTGG + Intergenic
996346950 5:122497924-122497946 TGCTCTGGGGAAGGCAGCGCTGG - Intergenic
997265190 5:132491035-132491057 TGCCCGGAGGAGGGCTGCCCGGG + Intergenic
997302195 5:132814054-132814076 GGCTCGGAGGCCGGCCCCCCCGG - Exonic
999169523 5:149581572-149581594 CGCACGGAGGTCGGCCGCCCGGG - Exonic
1002643224 5:180640425-180640447 GGCTAGGAGGAAGGCCGGGCTGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1005288991 6:24359992-24360014 AGCTCGGGCGCCGGCCGCGCGGG + Intergenic
1006911536 6:37566515-37566537 TGCTCTGATGGTGGCCGCGCGGG - Intergenic
1024604662 7:51013716-51013738 GGCTGGGAGGACGGCCCTGCTGG + Intergenic
1027050303 7:75017594-75017616 TGCTCCGAGGAGGGCAGCTCTGG - Exonic
1029382733 7:100224057-100224079 TGCTCCGAGGAGGGCAGCTCTGG + Exonic
1033477078 7:141701870-141701892 CGCTCGGGTGAGGGCCGCGCCGG - Exonic
1035265152 7:157685996-157686018 GGCCCGGAGGGCGACCGCGCGGG + Intronic
1039885425 8:41651449-41651471 TGCTGGGAAGAGGGCAGCGCGGG + Intergenic
1041040887 8:53844725-53844747 TGCTCGGAGAACGCCAGCCCAGG - Intergenic
1047262394 8:123274474-123274496 CGCGCGGAGGACGCGCGCGCGGG - Exonic
1052809498 9:33044554-33044576 TGCTGGAGGGACGGCCGCGTGGG + Exonic
1056832983 9:89931533-89931555 TCCTCGGAGGAGGGTCGTGCAGG - Intergenic
1061015990 9:127980998-127981020 GGCTAGGCGGGCGGCCGCGCGGG - Intergenic
1061413517 9:130433364-130433386 TGCTCGCAGGACTGCGGCACGGG + Exonic