ID: 1115610783

View in Genome Browser
Species Human (GRCh38)
Location 14:35046704-35046726
Sequence TGCTCGGAGGACGGCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115610783_1115610788 -6 Left 1115610783 14:35046704-35046726 CCTGCGCGGCCGTCCTCCGAGCA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1115610788 14:35046721-35046743 CGAGCAGGCCGCCCCAGCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115610783 Original CRISPR TGCTCGGAGGACGGCCGCGC AGG (reversed) Intronic