ID: 1115611477

View in Genome Browser
Species Human (GRCh38)
Location 14:35052494-35052516
Sequence CCTGAAGTTGGGCCAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115611477_1115611483 -10 Left 1115611477 14:35052494-35052516 CCCGCGCCTGGCCCAACTTCAGG 0: 1
1: 0
2: 1
3: 7
4: 212
Right 1115611483 14:35052507-35052529 CAACTTCAGGCAGTTTTATTAGG 0: 1
1: 0
2: 1
3: 11
4: 211
1115611477_1115611484 5 Left 1115611477 14:35052494-35052516 CCCGCGCCTGGCCCAACTTCAGG 0: 1
1: 0
2: 1
3: 7
4: 212
Right 1115611484 14:35052522-35052544 TTATTAGGAGTTTAAACTTGAGG 0: 1
1: 0
2: 1
3: 20
4: 208
1115611477_1115611485 12 Left 1115611477 14:35052494-35052516 CCCGCGCCTGGCCCAACTTCAGG 0: 1
1: 0
2: 1
3: 7
4: 212
Right 1115611485 14:35052529-35052551 GAGTTTAAACTTGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115611477 Original CRISPR CCTGAAGTTGGGCCAGGCGC GGG (reversed) Intronic
900461956 1:2805870-2805892 CCTGCAGATGGGCCAGGTGTGGG - Intergenic
901167964 1:7233307-7233329 GCTGAACATGAGCCAGGCGCTGG + Intronic
902298663 1:15485923-15485945 CCTGAAGCAGGGCCAGTTGCTGG + Exonic
902328092 1:15715901-15715923 CCTGAAGTTGTGCCATGCTGTGG + Intronic
905170945 1:36109159-36109181 CCTGTGGTTTGGCCAGGCCCTGG - Intronic
906191276 1:43900961-43900983 CTTGAAGTTGGGCCTGGCTAAGG - Intronic
906236369 1:44213687-44213709 CCTGAAGAAGGACCAGGCTCAGG - Exonic
907158706 1:52356238-52356260 CCTGCAGCTGGCCCAGGCTCAGG - Exonic
907238400 1:53067076-53067098 ACTGATGTTGGGTCAGGGGCAGG + Intronic
909336462 1:74480504-74480526 CCTGTAGTTGAGGCAGGGGCCGG + Exonic
910614558 1:89182806-89182828 CCTGGTTTTGGGCCTGGCGCTGG + Exonic
913199031 1:116481570-116481592 CCTGAGGTTGGGCAAGCCGGGGG - Intergenic
915368133 1:155326728-155326750 CCTGAGGTGGGCCCAGGGGCAGG - Exonic
916069079 1:161159624-161159646 CCTGAACTGGGGCCTGGCCCTGG + Exonic
917794238 1:178521359-178521381 CCTGAGGTTGTGCCAGGAGTAGG + Intronic
917922075 1:179759015-179759037 TCAGATGTTGGGCCAGGTGCTGG + Intronic
920450591 1:206058532-206058554 CCTGGTTTTGGGCCTGGCGCTGG - Intronic
921671161 1:217925289-217925311 CCCGCAGCTGGGCCAGGTGCCGG - Intergenic
922602011 1:226863574-226863596 CCTGAACTGAGGCCAGGCCCAGG + Intergenic
922804171 1:228377187-228377209 CGTGCAGCTGGGCCAGGTGCGGG - Exonic
922956237 1:229603135-229603157 CCTGAAGTTGGGCACAACGCAGG + Intronic
1062879647 10:967653-967675 CCTGACACTGGGCCAGGCGGAGG + Intergenic
1063947344 10:11191082-11191104 CCTGAGGTTGGGCAAGCTGCTGG + Intronic
1065905097 10:30243547-30243569 CCAGAATTTGGGCCAGGCACTGG - Intergenic
1066703394 10:38153196-38153218 TCTGAAGTTTGGCCATGGGCTGG + Intergenic
1066987393 10:42480027-42480049 TCTGAAGTTTGGCCATGGGCTGG - Intergenic
1067015193 10:42753201-42753223 CCCGAGGTTGGGCGGGGCGCAGG - Intergenic
1067842442 10:49691749-49691771 CCTGCAGGAGGGCCAGGGGCAGG + Intronic
1069656564 10:70093780-70093802 TCTGAAGATGGGCCAGGGGATGG + Exonic
1070139785 10:73730564-73730586 CCTGAAAGTCGTCCAGGCGCCGG - Intergenic
1070432558 10:76355849-76355871 CCTGAATGTGGGCCAGGTTCAGG - Intronic
1072832195 10:98670618-98670640 CCTGGTTTTGGGCCTGGCGCCGG - Intronic
1076778634 10:132711646-132711668 CTGGAAGGTGGGCGAGGCGCAGG - Intronic
1077051349 11:568377-568399 GCTGAAGTTGGGCCGAGAGCCGG - Intergenic
1077219920 11:1411315-1411337 CCTGAAGCTGGGGCCGGAGCAGG + Exonic
1078510045 11:11978269-11978291 CCTGGAGTGGGGTCAGGAGCAGG - Intronic
1082025200 11:47566184-47566206 GTTCAAGTTGGGCCGGGCGCGGG + Intronic
1083264969 11:61542392-61542414 CCTGCAGCTGGCCCAGGCTCTGG + Intronic
1083387777 11:62324669-62324691 CCTGAAGGCAGGCCAGCCGCTGG + Intergenic
1083898010 11:65629931-65629953 CCTAAAGTTGGGGCAGGCACAGG - Intronic
1084088399 11:66865255-66865277 CATGAGTTTGGGCCAGGCTCTGG - Intronic
1084214691 11:67640952-67640974 CATGGGGTTGGGCCAGGGGCCGG - Intergenic
1084649126 11:70478299-70478321 GCTGAACATGGGCCAGGGGCTGG + Intronic
1084951824 11:72670719-72670741 CCTGAAGTAGGGCCAGGCTGGGG - Intronic
1089531749 11:119134418-119134440 CCTGAAGGTGGCTCAGGGGCTGG - Exonic
1091211526 11:133864916-133864938 CCTGCAGATGGGCTACGCGCAGG - Intergenic
1091282648 11:134390846-134390868 CTCGAACCTGGGCCAGGCGCAGG + Exonic
1091656091 12:2347929-2347951 CCAGAAGAGGGGCCAGGAGCGGG + Intronic
1092894857 12:13001369-13001391 CCTCAAGCTGGGCCGGGCGGAGG + Intergenic
1095785232 12:46102181-46102203 CCTGAAGTTGGGCCACTCAGCGG - Intergenic
1096515378 12:52152530-52152552 CCTGAGGGTGGGCGCGGCGCGGG + Intergenic
1097182416 12:57178968-57178990 CATGAGGTGGGGGCAGGCGCAGG - Exonic
1097539120 12:60914110-60914132 CCTGAAGGTGGGGCAGGTGTGGG - Intergenic
1098197403 12:68016448-68016470 TCTGAAGTTGGGCCTGGTCCTGG + Intergenic
1100730916 12:97467801-97467823 CCTGAATTTGGGAGAGGCGGGGG + Intergenic
1102223363 12:111209995-111210017 CCAGACTTTGGGCCAGGCCCAGG - Intronic
1102462610 12:113109466-113109488 CCTTTAGATGGGCCAGGCCCCGG - Intronic
1103568721 12:121830321-121830343 CCTGAAATGGGGGCGGGCGCGGG - Exonic
1104774984 12:131385719-131385741 CCTGAGGTGGGCCCAGCCGCTGG - Intergenic
1112091827 13:96090954-96090976 CCCGAAGTTGGTGCAGGAGCTGG - Exonic
1112500146 13:99936658-99936680 CCTGAAGTTGGTCTGGGTGCTGG - Intergenic
1114070226 14:19099529-19099551 CCCAAGGTTGGGCGAGGCGCAGG + Intergenic
1115611477 14:35052494-35052516 CCTGAAGTTGGGCCAGGCGCGGG - Intronic
1119731791 14:76955976-76955998 CTAGAAGTTGGGCCTGGTGCTGG + Intergenic
1120745271 14:88146403-88146425 CCTGGAGTTGGGCCAGTTGGTGG - Intergenic
1122482505 14:102056105-102056127 CCTGGTTTTGGGCCTGGCGCCGG - Intergenic
1122537125 14:102473187-102473209 CCTGCAGTTGGTCCTGGCCCAGG - Intronic
1123139201 14:106058825-106058847 CCTGAACTGGAGCCAGGCACAGG - Intergenic
1124392408 15:29271479-29271501 CCTGGTTTTGGGCCTGGCGCTGG - Intronic
1128112838 15:65087378-65087400 CCAGAAGCTGTGCCAGGCGCAGG + Intergenic
1128160685 15:65421561-65421583 CCTGGAGATGGGCCTGGGGCTGG + Intronic
1129390731 15:75219573-75219595 CCTGGCTTTGGGCCTGGCGCTGG + Intergenic
1129615773 15:77098008-77098030 CCTGACTTTGGGGCAGGGGCTGG - Intergenic
1129707380 15:77802469-77802491 CCTGCAGAGGGGCCAGGAGCAGG + Intronic
1129823752 15:78620994-78621016 AGTGAAGCTGCGCCAGGCGCGGG + Exonic
1133171104 16:3983037-3983059 CCTGACGTTGGCCCAGATGCGGG - Intronic
1136245915 16:28975607-28975629 TCTCAAGTGGGGCCACGCGCTGG + Intronic
1137801669 16:51267137-51267159 CCTGAAGCTGGAGCAGGGGCTGG + Intergenic
1138453225 16:57106105-57106127 TCTGGAGTTGGGGCAGGCGGGGG - Intronic
1143013445 17:3879101-3879123 TCTTAGCTTGGGCCAGGCGCAGG - Intronic
1144647159 17:16982946-16982968 TCTTAAGTGGGGCCAGGTGCAGG - Intergenic
1145845408 17:28034262-28034284 GCAGAACTTGGGCCAGGCCCAGG - Intergenic
1146492430 17:33292408-33292430 CCAGAAGTAGTGCCGGGCGCCGG - Exonic
1147807284 17:43140783-43140805 CCAGACGTTGTGCCTGGCGCTGG - Intergenic
1148667015 17:49382566-49382588 CGTAAAGATGGGCCAGGCCCAGG - Intronic
1151598355 17:75091374-75091396 CCTGGAGCTGGGCCAGGAGGAGG + Intronic
1151954486 17:77373600-77373622 CCTGCGGGTGGGCCTGGCGCGGG + Intronic
1152125179 17:78442385-78442407 CCTGAACTGGGGCCAGCCTCAGG + Intronic
1152647059 17:81474169-81474191 CCTGCAGTTGGGCAAGGAGACGG + Intergenic
1153720201 18:7894046-7894068 TCTGAAGTTGAGCCAGGGGAGGG + Intronic
1153978605 18:10290716-10290738 CCTGAATATGGGCCTGGCTCAGG - Intergenic
1155142207 18:23053806-23053828 CCTGGAGTTGGAGGAGGCGCCGG + Intergenic
1158448896 18:57546148-57546170 CCTGAAGGTGGCCCAGGAACAGG - Intergenic
1159691965 18:71499760-71499782 CCAGAAGCTGGGGCAGGCGAGGG + Intergenic
1160600303 18:80007546-80007568 CCTGGTTTTGGGCCTGGCGCTGG + Intronic
1161326627 19:3667414-3667436 CCAGAAGGTGGGCCGGGGGCTGG - Intronic
1161701954 19:5800546-5800568 CCAGGAGTTGGGCCAGGTTCTGG - Intergenic
1161877372 19:6922100-6922122 CCCTAAGTAGGGCCAGGCACTGG + Intronic
1162296841 19:9819340-9819362 GCTGGAGTTGGGCGAGGCTCAGG + Intronic
1162327079 19:10005866-10005888 CCGGCAGTTGGGCCTGGCACTGG - Exonic
1165934621 19:39381645-39381667 GCAGAAGTTGGGCCAAGTGCGGG + Intronic
1166118019 19:40667580-40667602 TCTGGAGCTGGGGCAGGCGCTGG + Exonic
1167104469 19:47422000-47422022 CCTGGAGCTGGGCCAGGCAGCGG - Intergenic
1168096767 19:54120269-54120291 CCTGATGTCAGGCCAGGCTCAGG + Intronic
1168296108 19:55377968-55377990 CCTGCAGGTGGGCCAAGCGCCGG + Exonic
925221412 2:2144285-2144307 CCTGAAGGTGGCCCAGGCGTGGG - Intronic
925358154 2:3257241-3257263 CCTGCAGGTTGGCCAGGTGCAGG - Intronic
925942229 2:8831548-8831570 CCCCAAGCTGGGCCAGGCCCTGG + Intronic
928201755 2:29251629-29251651 CCTGCAGGTGGGACAGGCGTAGG + Intronic
930181959 2:48369247-48369269 AGTGAAGTTAGGCCAGGCGGGGG + Intronic
930785892 2:55271109-55271131 CCTGGTTTTGGGCCTGGCGCCGG - Intergenic
931267407 2:60672967-60672989 CCAGCAGTTGGGCCAGAGGCTGG - Intergenic
932233661 2:70103549-70103571 CCAGTAGCTGGGACAGGCGCCGG + Intergenic
932721727 2:74143590-74143612 CCTGAACTTGCCCCAGGCCCAGG - Intronic
933993480 2:87650422-87650444 CCTGAAGTTTGGCCAGTGGGTGG - Intergenic
934488281 2:94738065-94738087 CCTGAAGATGGGCTACACGCAGG + Intergenic
937930576 2:127201802-127201824 CCTCAAGTTGGGCAAGTGGCTGG - Intronic
938123028 2:128646906-128646928 CCTGGAGTAGGACCAGGTGCTGG - Intergenic
943621882 2:190157941-190157963 TCTGATTTTGGGCCTGGCGCCGG - Intronic
944801144 2:203238988-203239010 CCTTAAATTGGGCCAGGCTGAGG + Exonic
948702255 2:239767716-239767738 CCTGAGGTTGGCCCAGGAGAGGG - Intronic
948989850 2:241548259-241548281 CCTGCAGGTGGGCCTGGGGCTGG - Intergenic
1170570054 20:17627521-17627543 GCTGGAGGCGGGCCAGGCGCGGG - Exonic
1171230484 20:23480345-23480367 TCTGCAGAAGGGCCAGGCGCAGG + Intergenic
1171471834 20:25378336-25378358 CCAGATGTTGTGCCAGGCCCTGG - Intronic
1172060643 20:32185009-32185031 TCTGAAGTTGGGTCACGAGCTGG - Intergenic
1174084997 20:48001108-48001130 CCTGAGGCTGGGTGAGGCGCGGG - Intergenic
1176199906 20:63855527-63855549 CCTGAAGCTGGGCTGGGCGGCGG - Intergenic
1176256430 20:64155441-64155463 CCTGGAGCAGGGCAAGGCGCTGG + Intronic
1176839504 21:13827436-13827458 CCTGAAGATGGGCTACACGCTGG + Intergenic
1177375936 21:20270988-20271010 CCTGGTTTTGGGCCTGGCGCCGG - Intergenic
1179928477 21:44551408-44551430 CCAGGAGTTGGTGCAGGCGCTGG + Exonic
1180057213 21:45365147-45365169 CCTGGAGTTGGGCCAGGTCCCGG + Intergenic
1181026832 22:20131743-20131765 CCTTAAGGTGGACCGGGCGCTGG - Intronic
1181695628 22:24591504-24591526 CAGGAAGTTGGGCCAGGCAGGGG + Intronic
1183012945 22:34962131-34962153 CCTGGAGCTGGGCCAAGCACGGG + Intergenic
1183197144 22:36361305-36361327 CCTGCAGATGGGGCAGGCTCTGG - Intronic
1183597861 22:38823082-38823104 CCTTATCTTGGGCCAGGAGCAGG - Exonic
1183598172 22:38824727-38824749 GCTGAACTTGGGCCAGGCCAAGG + Intronic
1184012678 22:41760910-41760932 CCTGGTTTTGGGCCTGGCGCCGG + Intronic
1185062864 22:48616097-48616119 CCTGGAGCTGGGCCTGGGGCTGG + Intronic
1185257643 22:49844804-49844826 CCTGAAGTGGGGGCAGGCTGTGG - Intergenic
1185349411 22:50326814-50326836 CCTGGAGCTGGGCCAGGCGCTGG - Exonic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
954368057 3:50156481-50156503 CCTGAAGCTGGGCCAGGTTGGGG + Intronic
954642406 3:52108941-52108963 CCTGGAGGTGGGTCAGGCACAGG - Intronic
955291045 3:57692784-57692806 CCTGGAGCTGGGCCAGGCCGTGG - Exonic
955891858 3:63658690-63658712 CCAGATGTGGGGCCAGGCACTGG - Intronic
959060648 3:101613284-101613306 CCTGGTTTTGGGCCTGGCGCCGG + Intergenic
960158752 3:114325987-114326009 CCTGGGGTTGGGGCAGGTGCAGG + Intergenic
962259239 3:133892631-133892653 CCTGGAGATGGGCCAGGGGAAGG - Intronic
962530554 3:136276562-136276584 CCTGAACTTGGGCCAGGGCGGGG + Intronic
962769343 3:138597772-138597794 CCTGGTTTCGGGCCAGGCGCCGG + Intergenic
966514742 3:180806330-180806352 CCTGGAGTCCGGCCAGGCTCTGG + Intronic
967659726 3:192091772-192091794 CCTGGTTTTGGGCCTGGCGCCGG + Intergenic
967691431 3:192478356-192478378 TTTGGAGTTGGGCCAGGGGCTGG - Intronic
968078246 3:195828873-195828895 CCTGGACTTGTGCCAGGCACCGG + Intergenic
968514799 4:1011572-1011594 CCGGAAGTTGTGCCGGGGGCGGG + Intronic
968620144 4:1600270-1600292 CCTGAAGTTGGGGCACGCAGGGG + Intergenic
969056659 4:4406814-4406836 CCTGGGGTTGGGACAGGCTCTGG - Intronic
969710518 4:8840607-8840629 CTGGAAGCTGGGCCAGGCACGGG - Intergenic
972279875 4:37591484-37591506 CCTGAAGTTAAGCCATGCTCTGG - Exonic
979052258 4:115950479-115950501 CCTGGTTTTGGGCCTGGCGCTGG - Intergenic
979571316 4:122229133-122229155 TCTGAAGTTGGACAAGGCCCAGG - Exonic
982504421 4:156198874-156198896 CCTGGAGTTGGGCCACTCGGGGG - Intergenic
985573384 5:662534-662556 CCTGGAGCTGAGCCTGGCGCCGG - Exonic
989557999 5:42819431-42819453 CCTGGTTTTGGGCCTGGCGCCGG - Intronic
990376240 5:55173409-55173431 CCTGCGGCTGGGCCTGGCGCCGG + Intergenic
993989356 5:94637440-94637462 TCTCCAGTTGGGCCAGGCTCAGG + Intronic
1004465676 6:15882852-15882874 CCTGAAGGTTAGCCAGGGGCTGG - Intergenic
1005562263 6:27052675-27052697 CCTGGTTTTGGGCCTGGCGCCGG + Intergenic
1006152293 6:31995979-31996001 CCTGAGTTTGGCCCAGGAGCAGG + Exonic
1006158596 6:32028717-32028739 CCTGAGTTTGGCCCAGGAGCAGG + Exonic
1010317539 6:74468245-74468267 CCTGGTTTTGGGCCTGGCGCCGG - Intergenic
1010995135 6:82523880-82523902 CCTGGAGTTGGGCCATTCGGTGG - Intergenic
1011325734 6:86148714-86148736 CCTGGAGTTGGGCCACTCGGTGG + Intergenic
1018380222 6:163252274-163252296 GCTGACGCTCGGCCAGGCGCCGG + Intronic
1019352748 7:562572-562594 CCTGCAGGTGGGCCAAGCCCCGG + Intronic
1019515916 7:1440126-1440148 CCTCCAGGTGGGCCAGGCCCTGG - Intronic
1019516188 7:1441216-1441238 CCTGCAGTGGGGCGAGGCGGGGG + Intronic
1019689111 7:2400138-2400160 CCAGAGGTTGGGCCAGGCTGTGG + Intergenic
1020008004 7:4792445-4792467 CCTGAGGCTGGGCAAGGGGCAGG - Intronic
1020213200 7:6170523-6170545 CCTGAAGCTGGGTGAGCCGCCGG - Exonic
1020291034 7:6722337-6722359 CCTGAGGTTGGGACAGTGGCAGG - Intergenic
1020915487 7:14187268-14187290 CCAGATGTTGGGCCAGGCAGAGG - Intronic
1023170422 7:37385874-37385896 CCGGAAGCTGGGCCTGGCACTGG - Intronic
1027350282 7:77305012-77305034 CCTGGTTTTGGGCCTGGCGCCGG + Intronic
1028491503 7:91417410-91417432 CCTAGAGTTGTGCCAGGTGCTGG + Intergenic
1030126286 7:106155529-106155551 CCTGAAGGTGAGCCAGCCTCTGG - Intergenic
1033173908 7:139108414-139108436 CCTGAAGTTGTAGCAGCCGCGGG - Intronic
1033674515 7:143526842-143526864 CGTGAACTTTGGCCAGGCACTGG - Intergenic
1033697322 7:143802604-143802626 CGTGAACTTTGGCCAGGCACTGG + Intergenic
1034594896 7:152180772-152180794 CCTGAAGTTGGCACAGGTCCAGG + Exonic
1036696544 8:10978909-10978931 GCTGAAGCTGGGCCAGTGGCAGG - Intronic
1037793228 8:21966853-21966875 TCTCTAGTTGGGCCAGGCTCTGG - Exonic
1037802859 8:22044569-22044591 CCTGAACCTGGGCCAGGAGGCGG + Intronic
1037890299 8:22620567-22620589 CCAGAAGGTGGGCCAGGGCCGGG + Exonic
1041109117 8:54468791-54468813 TCTGAAGTTGGGACTGGAGCAGG - Intergenic
1045887968 8:107122687-107122709 TCTGAAATTGAGGCAGGCGCTGG - Intergenic
1048058305 8:130890763-130890785 ACTGAAGTTAGCCCAGGTGCTGG - Intronic
1053919303 9:42972541-42972563 CCTGAAGATGGGCTACACGCAGG - Intergenic
1054380640 9:64486319-64486341 CCTGAAGATGGGCTACACGCAGG - Intergenic
1054515107 9:66029992-66030014 CCTGAAGATGGGCTACACGCAGG + Intergenic
1054893043 9:70272828-70272850 CCTGAAGTTGTTCCAAGTGCTGG - Intronic
1056023238 9:82463728-82463750 CCTTAACTTGGGCTAGGCCCAGG + Intergenic
1057217324 9:93236256-93236278 CCTGAAGCTGTCCCAGGGGCTGG + Intronic
1058086782 9:100756316-100756338 CCTGAAGTTAGGTCAGGCATAGG - Intergenic
1059404498 9:114091731-114091753 CCTGCAGCTGGGCTAGGGGCGGG - Exonic
1061062592 9:128258090-128258112 CCAGCAGGTGAGCCAGGCGCCGG + Exonic
1061394772 9:130337918-130337940 CCTGCACCTGGGCCAGACGCAGG - Intronic
1061885744 9:133590306-133590328 CCTGAACTGGGACCAGGAGCTGG - Intergenic
1062188268 9:135230124-135230146 CCTGGAGTTGGGCCGGGCCATGG - Intergenic
1062394542 9:136347488-136347510 CCTGGAGATGTGCCAGGCGTAGG + Intronic
1062725935 9:138073598-138073620 CTTCAAGGTGGGCCAGGCGGGGG + Exonic
1188104133 X:26128417-26128439 CCGGGTGTTGGGGCAGGCGCCGG + Intergenic
1188897911 X:35693393-35693415 CCTGGTTTTGGGCCTGGCGCCGG - Intergenic
1189387620 X:40550262-40550284 CCTGAGTGTGGGCCTGGCGCGGG - Intergenic
1190740830 X:53287792-53287814 CCTGGGGCTGGGCCAGGCGGCGG + Intronic
1190945508 X:55089323-55089345 CCTGAAGATGGGGCAAGTGCTGG + Intronic
1195699245 X:107690043-107690065 TCTGGACTTGGGCCAGGAGCAGG + Intergenic
1196733277 X:118962869-118962891 CCTGAAGTTGTGTTAGGGGCTGG + Intergenic