ID: 1115613398

View in Genome Browser
Species Human (GRCh38)
Location 14:35070312-35070334
Sequence ATATTGTTATAGGCCGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115613398_1115613401 -3 Left 1115613398 14:35070312-35070334 CCGTGTCCGGCCTATAACAATAT 0: 1
1: 0
2: 1
3: 32
4: 357
Right 1115613401 14:35070332-35070354 TATTTTTTTTTTCTTTGCGTCGG 0: 1
1: 1
2: 96
3: 4252
4: 109277
1115613398_1115613403 22 Left 1115613398 14:35070312-35070334 CCGTGTCCGGCCTATAACAATAT 0: 1
1: 0
2: 1
3: 32
4: 357
Right 1115613403 14:35070357-35070379 TCTCGCTCTGTCGTCCAGGCTGG 0: 626
1: 30513
2: 100498
3: 203374
4: 199364
1115613398_1115613402 18 Left 1115613398 14:35070312-35070334 CCGTGTCCGGCCTATAACAATAT 0: 1
1: 0
2: 1
3: 32
4: 357
Right 1115613402 14:35070353-35070375 GGAGTCTCGCTCTGTCGTCCAGG 0: 389
1: 22411
2: 62960
3: 120758
4: 147583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115613398 Original CRISPR ATATTGTTATAGGCCGGACA CGG (reversed) Intronic
903785863 1:25860852-25860874 ATTTTGATATAGGCCAGGCATGG - Intergenic
903986083 1:27230003-27230025 AAATTATTTTAGGCCGGGCATGG + Intergenic
904068908 1:27777594-27777616 AGATTCTTCCAGGCCGGACACGG + Intronic
904138620 1:28333953-28333975 ATAGTGTTATTGGCTGGGCATGG + Intronic
904545769 1:31270147-31270169 ATAGTGTTATTGGCTGGGCAGGG - Intronic
905121097 1:35682529-35682551 AATTTGTTATAGGCCAGGCATGG - Intergenic
905736311 1:40329108-40329130 TTATAGTTTTAGGCCGGGCATGG + Intergenic
905926879 1:41757405-41757427 ATATTTTTTTGGGCCGGGCACGG - Intronic
906003371 1:42446365-42446387 ATATAGATACAGGCCAGACACGG + Intronic
906418422 1:45641526-45641548 ATATTGTTATGGGCTGGGTATGG + Intronic
906610153 1:47196077-47196099 TTATTGTGAGAGGCCGGGCACGG + Intergenic
906795155 1:48690875-48690897 ATTTTATTTTAGGCCGGGCATGG + Intronic
907294465 1:53440706-53440728 ATTCTGTTATAGGCTGGGCACGG - Intergenic
908079754 1:60563590-60563612 AAATTTTTACAGGCAGGACAAGG + Intergenic
908623880 1:66018125-66018147 ATGTGGTTTTAGGCCGGGCACGG + Intronic
909237871 1:73176423-73176445 ATATTGATGCTGGCCGGACATGG + Intergenic
909893908 1:81041899-81041921 ATTTCGTTATAGGCTGGAGAAGG + Intergenic
909916232 1:81323146-81323168 ATATGTTTATAGGCCGGGCACGG - Intronic
910864035 1:91771412-91771434 AAAATATTATGGGCCGGACACGG + Intronic
911041394 1:93593663-93593685 GTAGTGTAATAGGCCGGGCATGG - Intronic
911077355 1:93890198-93890220 ATATTTTTCGAGGCCGGGCACGG - Intronic
911340445 1:96629721-96629743 ATATTCTTCTAGGCTGGACGCGG - Intergenic
912055590 1:105594630-105594652 ATTTTGGTAGAGGCCGGGCATGG + Intergenic
912479921 1:109975183-109975205 AGATTATTTTAGGCCGGGCATGG + Intergenic
913101509 1:115572027-115572049 AAATAGTTATAGGCCAGGCATGG + Intergenic
913471826 1:119195972-119195994 ATATTGATAAAGGCCCTACAAGG + Intergenic
914213366 1:145602444-145602466 ATAGTATTATAGGCCAGGCATGG - Intergenic
914775721 1:150732897-150732919 ATATAGTTTGAGGCCGGGCACGG - Exonic
915373767 1:155374036-155374058 ATAATTTTAAAGGCCGGGCACGG + Intronic
916751715 1:167728973-167728995 ATGCTGTTATCGGCCGGGCATGG + Intronic
918271096 1:182900719-182900741 ATTTTGTTATTGGCTGGGCATGG - Intronic
918810094 1:189106023-189106045 AAATTGTTATAGACCAGAGAAGG + Intergenic
920322757 1:205137225-205137247 AAATTGTTCTTGGCCGGGCATGG + Intergenic
920819355 1:209365860-209365882 ATAATGCTATAGGCCAGGCACGG + Intergenic
922502384 1:226106934-226106956 ATTTAGTTCTAGGCTGGACATGG + Intergenic
1063899130 10:10713742-10713764 ATATGGGGATAGGCCGGGCACGG + Intergenic
1064290951 10:14033492-14033514 AAAATGTGATAGGCCGGGCATGG + Intronic
1065277188 10:24097131-24097153 ATAATGTAATAGGCCAGGCATGG + Intronic
1065702062 10:28435272-28435294 AAAAAGTTATAGGCCGGGCATGG - Intergenic
1067114722 10:43426338-43426360 AAAATGTTTTTGGCCGGACACGG + Intergenic
1067949079 10:50711381-50711403 ATATGAATATAGGCCGGGCATGG + Intergenic
1068459004 10:57301633-57301655 AGAATGTTATGGGCGGGACATGG - Intergenic
1069989051 10:72303324-72303346 AAATTAATATAGGCCGGGCACGG - Intergenic
1071047924 10:81406165-81406187 ATGTATTTATAGGCCGGACATGG - Intergenic
1071924654 10:90392111-90392133 ATATTGTCATGGGCCGGGCGCGG + Intergenic
1072007853 10:91272480-91272502 TTATTTTTTTAGGCCAGACACGG + Intronic
1072581417 10:96743278-96743300 AAATTGTTTTAGGCCGGGCACGG + Intergenic
1072847683 10:98850444-98850466 ATATTATTTTGGGCCGGGCACGG + Intronic
1075760935 10:124856050-124856072 ATCTTTTTTTAGGCCGGGCATGG - Intergenic
1077971014 11:7190258-7190280 ATATTTATATAGGCCAGGCATGG + Intergenic
1080847977 11:36043019-36043041 AAATTATTATAGGCTGGGCATGG + Intronic
1082045668 11:47724369-47724391 ATATGTTTAAAGGCCGGGCACGG - Intronic
1083054283 11:59804905-59804927 AAACTGTTATAGGCCGGGCACGG + Intergenic
1083704560 11:64505145-64505167 ATCTTGTTCTAGGAGGGACAGGG - Intergenic
1083872143 11:65495361-65495383 ATATTTTTAAAGGCCGGGCATGG + Intergenic
1085307344 11:75494975-75494997 ATATATATATAGGCTGGACATGG + Intronic
1085676945 11:78530755-78530777 ATCTAGTCATAGGCCGGGCACGG - Intronic
1090281417 11:125459299-125459321 ATAGTTTTCTAGGCCGGGCATGG + Intronic
1090815790 11:130294116-130294138 ATCCAGTTATAGGCCGGGCACGG + Intronic
1091753132 12:3034801-3034823 AAATAGTTATAGGCCAGACGCGG + Intronic
1092338928 12:7659002-7659024 ATATATTTATAGGCCGGGCGCGG + Intronic
1092602714 12:10083761-10083783 AAATTTGTTTAGGCCGGACATGG - Intronic
1092650215 12:10626714-10626736 AAGTTGTTTTAGGCCGGGCACGG + Intronic
1093427896 12:19049975-19049997 ATATTTTTTTAGGCCGGGCTTGG + Intergenic
1093552249 12:20427913-20427935 ATAATATTTTAGGCCGGGCATGG + Intronic
1093552331 12:20428569-20428591 ATAATATTTTAGGCCGGGCATGG - Intronic
1093914909 12:24790510-24790532 AAGTTGTTATTGGCCGGGCACGG - Intergenic
1093980925 12:25474577-25474599 ATATAGTTATAGGCCAGGCACGG - Intronic
1094024434 12:25947612-25947634 AAATTGTTATAGGCTGGCCAGGG - Intergenic
1094635304 12:32221391-32221413 ATAATTTTATAGGCCGGGCATGG + Intronic
1094655141 12:32412485-32412507 AAATTGTTATAGGCTGGGTATGG + Intronic
1094770723 12:33655508-33655530 ATATTATTTTAGGCCAGGCACGG + Intergenic
1095120658 12:38414343-38414365 ACATTGTTATTGGCCGGGCACGG - Intergenic
1097132576 12:56823473-56823495 AAATTGTTCTGGGCCGGGCACGG - Intergenic
1097946519 12:65375133-65375155 AGATTGATATAGGCCGGGCGCGG - Intronic
1098328607 12:69329002-69329024 ATATTGTTAGAAGCTGGAAAGGG + Intergenic
1098505807 12:71249402-71249424 AGAAAGTTATAGGCCGGGCACGG + Intronic
1101154321 12:101913413-101913435 ATAGTATTTTAGGCCGGGCACGG + Intronic
1101956053 12:109213352-109213374 ATACATTTATAGGCCAGACATGG - Intronic
1102055943 12:109896629-109896651 ATATTGATTGAGGCCGGGCATGG + Intergenic
1102267560 12:111500582-111500604 ATAATTTTAAAGGCCGGGCACGG + Intronic
1103442776 12:120975863-120975885 ATATTTTTTGAGGCCGGGCATGG + Intergenic
1103650231 12:122426212-122426234 ATATTGTTGTGGGCCAGGCACGG - Intergenic
1104363618 12:128156469-128156491 AAACTGATATAGGCCGGACATGG - Intergenic
1105033925 12:132904710-132904732 ATGTTTTTATAGGCCGGGCGCGG - Intronic
1105495562 13:20927679-20927701 TTATTATTTTAGGCCGGGCATGG - Intergenic
1107172071 13:37354691-37354713 ATAATCTTATAGGCCGGGCGCGG - Intergenic
1107631912 13:42351230-42351252 ATATCATTATTGGCCGGACCTGG - Intergenic
1108085365 13:46784364-46784386 ATATTGTTATTGGGCACACATGG + Intronic
1108329152 13:49367624-49367646 AAATGTTTATAGGCCGGGCACGG + Intronic
1108368729 13:49745771-49745793 ATATATGTATAGGCCGGGCACGG + Intronic
1110162793 13:72399690-72399712 ATAGAGTTATAGGCCGGGCACGG + Intergenic
1110454490 13:75675362-75675384 ATGTTGTAACAGGCCGGGCACGG - Intronic
1110949634 13:81469141-81469163 AAGTTGTTATAGGCCGGGCGCGG - Intergenic
1111948194 13:94687526-94687548 ATATAATTATAGGCCGGGCATGG - Intergenic
1112210997 13:97376940-97376962 ATATTGTTCTAGGCAGGACATGG - Intronic
1114157214 14:20118448-20118470 ATAATGGTAGAGGCCGGGCATGG + Intergenic
1114313622 14:21490185-21490207 TAATTGTTATAGGCCGGGCGCGG + Intronic
1114850537 14:26378021-26378043 ATATTGTTCCAGGCTGGGCATGG + Intergenic
1115613398 14:35070312-35070334 ATATTGTTATAGGCCGGACACGG - Intronic
1115657937 14:35462074-35462096 ATATTGTTACAGGCTGGGCATGG - Intergenic
1115980865 14:39050056-39050078 AAATTGTTTTTGGCCGGGCACGG - Intronic
1118500182 14:66355139-66355161 ATATTATTATTAGCCAGACATGG - Intergenic
1118563629 14:67115440-67115462 ATATGGTTTCAGGCCGGGCATGG + Intronic
1119234961 14:73011810-73011832 ACAATGTTTTAGGCCAGACATGG - Intronic
1119534402 14:75391146-75391168 AAATATTTATAGGCCAGACATGG + Intergenic
1119743932 14:77031018-77031040 ATACTGTAATAGGCCGGTCACGG - Intergenic
1122218548 14:100220573-100220595 ATATTTCTGTAGGCCGGGCATGG - Intergenic
1122457651 14:101866924-101866946 AAATTTTTTTAGGCCGGGCACGG + Intronic
1123502335 15:20900471-20900493 ATATTATTTCAGGCTGGACATGG - Intergenic
1123559585 15:21474155-21474177 ATATTATTTCAGGCTGGACATGG - Intergenic
1123595821 15:21911452-21911474 ATATTATTTCAGGCTGGACATGG - Intergenic
1124927184 15:34081988-34082010 TTAGTGTTTTAGGCCGGGCACGG - Intergenic
1125138673 15:36376338-36376360 ACATTGTTAAAGGCCAGACATGG + Intergenic
1125504573 15:40259493-40259515 ATTTTGTTTTTGGCCGGACGCGG + Intronic
1125529355 15:40401830-40401852 ATATGGGTATAGGCCGGGCGCGG - Intergenic
1126791828 15:52228430-52228452 ATATTGTTACCTGCCGGGCACGG - Intronic
1129076631 15:73002470-73002492 ATTTTGTTTTAGGCCGGGCGCGG - Intergenic
1129437604 15:75554615-75554637 GTATTGATCTAGGCCGGGCATGG - Intronic
1129802568 15:78426945-78426967 ATATTATTACAGGCTGGGCACGG - Intergenic
1131187616 15:90288434-90288456 ACATTCTTAGAGGCCGGGCATGG + Intronic
1131954935 15:97724939-97724961 ATATTCTTCTAGGCCAGGCACGG + Intergenic
1202967931 15_KI270727v1_random:201315-201337 ATATTATTTCAGGCTGGACATGG - Intergenic
1132952738 16:2573529-2573551 ATAGAGTTATTGGCCGGGCACGG + Intronic
1132961613 16:2626641-2626663 ATAGAGTTATTGGCCGGGCACGG - Intergenic
1133153209 16:3852459-3852481 ATAATGTAATCGGCCGGGCACGG - Intronic
1134473643 16:14551220-14551242 ATATGGTTCTAGGCTGGGCATGG - Intronic
1134473771 16:14552656-14552678 ATAGTGTTAGAGGCCGGGCGCGG + Intronic
1134747220 16:16597633-16597655 AAATTAATATAGGCCGGGCATGG - Intergenic
1135102419 16:19617704-19617726 AGACTGTGATAGGCCGGGCACGG + Intronic
1135705824 16:24673846-24673868 ATATTTCTTGAGGCCGGACATGG - Intergenic
1138114849 16:54352186-54352208 CTGTTTATATAGGCCGGACATGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138317727 16:56084612-56084634 ATAGTGTTTTAGGCTGGGCATGG + Intergenic
1139937449 16:70581790-70581812 AACTTGTTAGGGGCCGGACATGG + Intronic
1142819071 17:2449496-2449518 AAATTGTTTTAAGCCAGACATGG - Intronic
1143828695 17:9633493-9633515 ATATATTTATAGGCCAGGCATGG - Intronic
1145096493 17:20033252-20033274 ATATATATACAGGCCGGACATGG - Intronic
1146010308 17:29188799-29188821 TTATTGTTTAAGGCCGGGCATGG - Intergenic
1146012995 17:29210636-29210658 ATATTGATGGAGGCCGGGCACGG + Intergenic
1147933774 17:43999451-43999473 GTTTTGTTAGAGGCCGGGCACGG + Intronic
1148000984 17:44386968-44386990 ATTTTTTTATAGGCTGGGCATGG + Intronic
1148116528 17:45178478-45178500 TTATTGTTGTAGGCCGGGCGCGG + Intergenic
1148116577 17:45178791-45178813 AAATTGTTGTAGGCTGGGCATGG + Intergenic
1149191278 17:54066072-54066094 ATATTGTGTTAGGCCAGGCATGG - Intergenic
1149884174 17:60324710-60324732 AAACTGTTATAGGCCAGGCATGG + Intronic
1150251638 17:63708169-63708191 ACCTGGTTATAGGCCGGTCACGG - Intronic
1151222263 17:72621881-72621903 ATTTTGTTTTAGGCTGGGCATGG - Intergenic
1151817900 17:76480375-76480397 ATATATATATAGGCCGGGCATGG - Intronic
1152859612 17:82688322-82688344 AAATTGTTTTGGGCCGGGCACGG + Intronic
1153101114 18:1470629-1470651 ATATTGTAATAGGCAGGGGATGG - Intergenic
1153249675 18:3108827-3108849 ATGCTGTCATTGGCCGGACACGG - Intronic
1153251217 18:3124125-3124147 ATAGCTTTATAGGCCGGGCATGG - Intronic
1153838456 18:8985133-8985155 AAATAGTTGTAGGCCGGGCACGG - Intergenic
1153888659 18:9491845-9491867 AAATTGTTAGGGGCCGGTCATGG - Intronic
1154153978 18:11929482-11929504 ATAATGATATAGGCCAGGCATGG + Intergenic
1156202578 18:34851390-34851412 ATATAGTTTTAGGCCAGGCATGG - Intronic
1157184323 18:45525176-45525198 AAATTTTTATAGGATGGACAAGG - Intronic
1157648216 18:49299751-49299773 ATATTCATATGGTCCGGACACGG + Intronic
1157961066 18:52153859-52153881 TTATTTGTATAGGCCGGGCATGG - Intergenic
1159169509 18:64746829-64746851 ATAATGTAATAGGCCGGGCACGG - Intergenic
1159265397 18:66072964-66072986 ATATTGTCATAGGAGGGACCTGG - Intergenic
1159355417 18:67333511-67333533 ATACAGATATAGGCCGGACATGG + Intergenic
1160862337 19:1242697-1242719 AAATAGTTTTAGGCCGGGCACGG + Intronic
1161797921 19:6398142-6398164 GTATTGTTTTGGGCCGGGCACGG - Intergenic
1162347432 19:10127897-10127919 AAAATGTCATAGGCCGGGCATGG + Intergenic
1163027891 19:14523912-14523934 ATGTTATTATAGGCCAGACATGG - Intronic
1164244409 19:23417775-23417797 ATAATGGTATTGGCCGGGCACGG - Intergenic
1164774695 19:30843901-30843923 ACATTTTTTTAGGCCGGGCAAGG + Intergenic
1165249549 19:34518763-34518785 ATATTATTCTAGGCCAGGCATGG + Intergenic
1165591256 19:36972121-36972143 AAAATGTTATAGGCTGGGCACGG - Intronic
1165751018 19:38259938-38259960 ATAATGTTAGAGGCCAGGCATGG - Intronic
1165985267 19:39763183-39763205 AAATTGTCATAGGCTGGGCATGG + Intergenic
1167635449 19:50652137-50652159 AAATAATTATAGGCCGGGCATGG - Intronic
1167965885 19:53146263-53146285 AAATTTTTTTAGGCCGGGCACGG - Intronic
926713064 2:15898642-15898664 ATATTTTTAAAGGTCGGGCATGG + Intergenic
926738542 2:16092573-16092595 ATGTTGTTCTAGGCCTGGCATGG - Intergenic
926925169 2:17980123-17980145 ATATTGTCATAGCCCTGAGAAGG - Intronic
927787769 2:25985579-25985601 ATATTTTTTTAGGCCGGGCGCGG + Intergenic
929315684 2:40475421-40475443 TAATTTTTATAGGCCGGGCACGG - Intronic
929498932 2:42473184-42473206 ATATTGTTGAGGGCCGGACGCGG - Intronic
930565937 2:53020591-53020613 ATATTGTTCTCGGCCGGGCGTGG - Intergenic
931320307 2:61169145-61169167 AAGTTGTTTTAGGCCGGGCACGG - Intergenic
934667612 2:96183892-96183914 AAAATGTTATAGGCCGGGCACGG + Intergenic
935289777 2:101600341-101600363 ATATTATTTTCGGCCGGGCATGG + Intergenic
935308547 2:101760198-101760220 ATATTTTTATAGGCCGGGTGTGG + Intronic
937106915 2:119324482-119324504 AATTTGTTATGGGCCGGACATGG - Intronic
937348856 2:121146698-121146720 ATATGGTTTTAGGCCAGGCATGG - Intergenic
937928189 2:127183703-127183725 ATAGTGTTAGAGGCCGGGCGTGG - Intergenic
938050317 2:128163886-128163908 ATATTGAAATAGGCTGGGCACGG + Intronic
938320926 2:130363107-130363129 TTATTGTGGTAGGCCGGGCACGG - Intronic
940222049 2:151363023-151363045 ACTTTATTTTAGGCCGGACACGG + Intronic
940472412 2:154115709-154115731 AAATTCTAATAGGCCGGGCATGG - Intronic
940933966 2:159469729-159469751 ATGTAGGTATAGGCCGGGCATGG - Intronic
941833653 2:169991870-169991892 ATGTTGTTTTAGGCCAGGCACGG - Intronic
941953933 2:171185127-171185149 ACATAGTTATAGGCCGGGCTCGG - Intronic
941972928 2:171371645-171371667 ACCTTGTTATAGGCTGGGCACGG - Intronic
945248243 2:207740963-207740985 ATATTTTTTCAGGCCGGGCACGG + Intronic
947662548 2:231880538-231880560 ACAGTGTTATAGGCCGGGCACGG - Intergenic
948377662 2:237532352-237532374 ATATTGTTCAAGCCCAGACAAGG + Intronic
1169237446 20:3942457-3942479 ATATTTGTCCAGGCCGGACACGG - Intronic
1169370511 20:5025575-5025597 AAATTTTTTTAGGCCGGACACGG + Intergenic
1171421723 20:25022064-25022086 ACAATATTTTAGGCCGGACACGG + Intronic
1172415576 20:34764401-34764423 TAAATGTTATAGGCCGGACGCGG + Intronic
1172849667 20:37952232-37952254 ACATTGTTATAGGCCAGGCATGG - Intergenic
1172989463 20:39022444-39022466 ATATGATAATAGGCCGGGCACGG - Intronic
1173363285 20:42363598-42363620 TTATTGTAATAGGCCGGGCACGG - Intronic
1173514963 20:43658605-43658627 ATAGTCTTATAGGCCGGGCATGG + Intergenic
1173525599 20:43730179-43730201 ATATTATTTTAGGCCAGGCATGG - Intergenic
1173820490 20:46016685-46016707 AAAGTGTTCTAGGCCGGGCACGG + Intergenic
1174799179 20:53548805-53548827 ATATTTATTCAGGCCGGACATGG + Intergenic
1174834977 20:53848733-53848755 ATATTAATATAGGCCGGGCACGG + Intergenic
1175955885 20:62609119-62609141 GAATTGTTTTAGGCCGGGCATGG - Intergenic
1176628247 21:9113496-9113518 ATTTTTTTATAGGCTGGGCATGG - Intergenic
1178135468 21:29622235-29622257 ATATTCTTAGAGGCCGGGCGTGG - Intronic
1178390535 21:32194367-32194389 ATATAGATATAGGCCAGGCATGG + Intergenic
1178564939 21:33675271-33675293 ATCTTGATATGGGCCGGGCACGG + Intronic
1180256205 21:46629774-46629796 ATATTGGCATTGGCCGGGCACGG + Intergenic
1181492109 22:23267025-23267047 AGATGGTTATAAGCAGGACAGGG - Intronic
1182781108 22:32868739-32868761 AAATATTTATAGGCCGGGCACGG - Intronic
1184267207 22:43355067-43355089 ATGTGGTTTTTGGCCGGACATGG + Intergenic
952323619 3:32300666-32300688 ATATTCTTTTAGGCTGGGCACGG + Intronic
953696711 3:45165589-45165611 ATATTGTGTTAGGCCGGGCGCGG - Intergenic
953750809 3:45607082-45607104 ATTTGGTTATAGGCCAGGCATGG - Intronic
953860589 3:46541041-46541063 ATATTAGGATAGGCCGGGCATGG + Intronic
954086794 3:48251039-48251061 AAATTGATCTAGGCCGGGCACGG - Intronic
954087927 3:48260697-48260719 AAATTGATCTAGGCCGGGCACGG - Intronic
954159748 3:48712534-48712556 ATTTTATTGTAGGCCGGGCATGG - Intronic
954168329 3:48779115-48779137 ACATTTTTTTAGGCCGGGCACGG - Intronic
954815962 3:53280780-53280802 ATCTTATTGTAGGCCGGGCATGG + Intergenic
954827878 3:53391110-53391132 AGATTATTACCGGCCGGACAAGG - Intergenic
955263845 3:57422482-57422504 ATTTTGTTAGAGGCCGGGCGCGG - Intronic
955559919 3:60177847-60177869 ATTTTGGTATAGGCTGGACTGGG + Intronic
956982641 3:74656666-74656688 ATTTGGTTATAGGCCAGGCATGG - Intergenic
957691593 3:83577864-83577886 GTATTATTATAGGCTGGGCATGG + Intergenic
959210345 3:103370714-103370736 AGATTCTTTTAGGCCGGGCAGGG - Intergenic
960128674 3:114028573-114028595 ATAGTTTTAGAGGCCGGGCACGG - Intronic
961612927 3:128154737-128154759 ATGTTGGTACAGGCCGGACGTGG - Intronic
962518631 3:136177382-136177404 ATAATGCTACAGGCCGGGCACGG + Intronic
963873111 3:150441467-150441489 ATATTATTGGAGGCCGGGCATGG + Intronic
964120015 3:153173700-153173722 ATAGTGTTGTAGGCCGGGCGTGG - Intergenic
965095292 3:164217665-164217687 ACATTGTTATAGGCTGGGAAGGG + Intergenic
965234764 3:166102772-166102794 ATATTGTTTTAGGCCAGGCGCGG - Intergenic
965577362 3:170231249-170231271 ATATAGGAATAGGCCGGGCACGG - Intronic
965968438 3:174524828-174524850 ATAATCTTATAGGCCGCGCATGG - Intronic
966422464 3:179746853-179746875 ATATAGGTTGAGGCCGGACATGG - Intronic
969035093 4:4247052-4247074 ATTTAGTTATAGGCTGGGCAGGG - Intronic
969138453 4:5049875-5049897 ATATTGTGCTAGGCCGGGCGTGG - Intergenic
970617991 4:17785611-17785633 GCATTATTATAGGCGGGACATGG - Intergenic
971801518 4:31299016-31299038 ATACTGTTATATGCCTGATATGG + Intergenic
972486697 4:39548480-39548502 ATTTTGTTTTAGGCCAGTCATGG - Exonic
973869370 4:55149527-55149549 ATATGATTAGAGGCCGGGCACGG - Intergenic
974004103 4:56538516-56538538 ACATTATTTTAGGCCGGGCATGG + Intronic
974466881 4:62269179-62269201 ATATTGCTAAAGGCAGGTCAGGG + Intergenic
976250388 4:83044485-83044507 AGATTAGTATAGGCCGGGCACGG + Intronic
976448059 4:85154363-85154385 ATATTATTTTAGGCTGGGCATGG - Intergenic
976491757 4:85678837-85678859 ATTTTGTTATAGGAAGTACAAGG + Intronic
976651588 4:87440555-87440577 ATATGGTTGCAGGCCGGGCATGG + Intronic
977113105 4:92985525-92985547 ATATTTTTACCGGCCGGACGCGG - Intronic
977267936 4:94878393-94878415 TTATTTTTATAGGCTGGAAAGGG + Intronic
978952290 4:114575461-114575483 ATGCTGTTATAGGCAGGGCATGG - Intergenic
979129059 4:117016777-117016799 ATATCATTATAGACCAGACATGG - Intergenic
979848992 4:125553512-125553534 AGATTGTTAGAGGCCGGGCGCGG + Intergenic
979947082 4:126845631-126845653 ATATTTTTTTAGGCCGGGCGCGG + Intergenic
980610318 4:135152145-135152167 AAAGTGTTATGGGCTGGACATGG + Intergenic
981093896 4:140759137-140759159 AGATTGTTGTAGGCCGGGCATGG - Intergenic
981119073 4:141027616-141027638 AGATTTTTATAGGCCAGACTGGG - Intronic
981847710 4:149188522-149188544 ATATTTTTAAAGGCCAGACTTGG + Intergenic
982178293 4:152727160-152727182 ATATTGCTTTAGGCCGGGCTTGG - Intronic
984670569 4:182481502-182481524 ATATGATTATAGGCCGGGCACGG + Intronic
984733840 4:183092405-183092427 TTGTAGTTATAGGCCGGGCACGG + Intergenic
984912554 4:184687904-184687926 ATATTGTTTATGGCCGGGCACGG - Intronic
985215767 4:187652001-187652023 ATATCAATATAGGCCGGGCACGG + Intergenic
986095743 5:4552452-4552474 ATAGTATTATAGGCTGGGCATGG - Intergenic
987385576 5:17326183-17326205 ATATTATTAAAGGCCAGGCATGG + Intergenic
987470420 5:18321052-18321074 AAATTGTTTTAGGCTGGGCATGG - Intergenic
990478144 5:56181883-56181905 ATACAGAAATAGGCCGGACACGG - Intronic
990645493 5:57839075-57839097 ATTTTTTTATGGGACGGACAGGG - Intergenic
990805770 5:59659892-59659914 ATATTGAAGTAGGCCGGGCATGG + Intronic
991014716 5:61918464-61918486 ATGTTGTTTGAGGCCGGGCATGG - Intergenic
991509091 5:67356928-67356950 ATATTTTCAGTGGCCGGACATGG - Intergenic
991584160 5:68185867-68185889 AAATTGTTTTAGGCCAGGCACGG - Intergenic
992147870 5:73870157-73870179 ATTTTGTAATAGGCAGGAGAAGG + Exonic
992983392 5:82201173-82201195 ATATATTTTTAGGCCGGGCAAGG - Intronic
993768308 5:91891575-91891597 ATATTATTATAGGCCAGATCAGG + Intergenic
994421809 5:99533178-99533200 ATTTTTTTGTAGGCCGGGCATGG + Intergenic
995231077 5:109764089-109764111 AAGTTATAATAGGCCGGACACGG - Intronic
995553278 5:113301173-113301195 AGATAGTTACAGGCCGGGCATGG + Intronic
996006920 5:118432295-118432317 ATAGTGTTACTGGCCGGGCACGG - Intergenic
996536208 5:124580773-124580795 ATCTTGTTAAAAGCTGGACATGG - Intergenic
996730629 5:126714431-126714453 AAATTATTATAGGCTGGGCATGG + Intergenic
999390830 5:151188312-151188334 ATAATGTTCAAGGCCGGGCACGG + Intronic
999806889 5:155089631-155089653 ATAGTGTTAGAGGACAGACATGG - Intergenic
1000343131 5:160293126-160293148 ATAATGTTTTAGGCTGGGCATGG + Intronic
1000425878 5:161091153-161091175 AAATAGTTTTAGGCTGGACATGG + Intergenic
1000505013 5:162105718-162105740 AGATTGTTCTAGGCCGGGCGCGG - Intronic
1001510700 5:172319256-172319278 CTGTTGCTATAGGCCGGGCACGG - Intergenic
1004378849 6:15114939-15114961 ATAGAGTTATAGGCCAGGCATGG + Intergenic
1005564494 6:27077082-27077104 AAATTGAAATAGGCCGGGCATGG + Intergenic
1005942147 6:30568609-30568631 AAAATGTTATAGGCCAGGCATGG + Intergenic
1006127547 6:31849536-31849558 AAATTTTTTTAGGCCGGGCACGG - Intergenic
1006308334 6:33238967-33238989 AAATTTTTGTAGGCCGGGCATGG + Intergenic
1006631521 6:35433593-35433615 GAATAGTTATAGGCCGGGCATGG + Intergenic
1009209540 6:60845336-60845358 AAATCATTTTAGGCCGGACACGG + Intergenic
1009586361 6:65610195-65610217 ATAGTTTAATAGGCCGGGCATGG - Intronic
1010636807 6:78270177-78270199 ATAAAGTGATAGGCCGGACGCGG + Intergenic
1010721826 6:79291207-79291229 AGATTTTTGTAGGCCAGACACGG - Intergenic
1011677847 6:89752832-89752854 ATATTCTTATGGGCCGGGCACGG + Intronic
1011908040 6:92397460-92397482 ATATTGTTATAGCATGAACATGG - Intergenic
1011940007 6:92831260-92831282 TTATTATTATTGGCCAGACATGG - Intergenic
1013871068 6:114760542-114760564 TTATTAATATAGGCCGGGCATGG - Intergenic
1014823033 6:126014537-126014559 ATATAGGAATTGGCCGGACACGG - Intronic
1016594067 6:145778884-145778906 AGATTGTGATAGGCCAGGCACGG - Intergenic
1017838619 6:158203325-158203347 AAAATGTTCTAGGCCGGGCACGG + Intergenic
1018707513 6:166473827-166473849 GGATGGTTATAGGCTGGACATGG - Intronic
1020001824 7:4760558-4760580 ATACTGTTCTAGGCCGGGCGCGG + Intronic
1020729393 7:11862655-11862677 ATATGGTTTTAGGCCGGGCGCGG - Intergenic
1021160941 7:17272131-17272153 ATATTGTCAGAGGCCGGGCGCGG + Intergenic
1021759246 7:23887375-23887397 ATATTATTTTAGGCCGGGCGCGG + Intergenic
1023357010 7:39377419-39377441 ATATAATTATAGGCCGTGCATGG - Intronic
1025063205 7:55829086-55829108 ATATGGTGCTAGGCCGGGCACGG + Intronic
1025529836 7:61866173-61866195 ATAGTGTTTCAGGCCGGGCACGG + Intergenic
1025972243 7:66337597-66337619 ATAGTTTTGTCGGCCGGACATGG - Intronic
1026398811 7:69987758-69987780 ATGTTTTTAAAGTCCGGACATGG - Intronic
1027756392 7:82218222-82218244 ATAATGTAGTCGGCCGGACACGG - Intronic
1027872678 7:83730274-83730296 ATATAGTTATAGGCTGGATGGGG - Intergenic
1029412219 7:100421209-100421231 ACATGGTTCTAGGCTGGACATGG - Intronic
1029426831 7:100500221-100500243 ATATTTTTTTAGGCTGGGCATGG - Intergenic
1030237685 7:107284212-107284234 ATGTTAATATAGGCCGGGCACGG - Intronic
1031050934 7:116944788-116944810 ATAATTTTGAAGGCCGGACATGG + Intergenic
1031166972 7:118240862-118240884 ATATAGTTATTGGCCGGGCGCGG + Intronic
1031209632 7:118805964-118805986 ATTATGTTATGGGCCGGGCACGG + Intergenic
1031524769 7:122810882-122810904 ATATTTTTTTAGGCTGGGCATGG - Intronic
1033052935 7:138022813-138022835 AGATTTTTAGAGGCCGGGCACGG + Intronic
1033536185 7:142313944-142313966 ATCATGTAATAGGCCGGGCATGG + Intergenic
1034945424 7:155258904-155258926 ATATACATATAGGCCGGGCATGG - Intergenic
1035889434 8:3327421-3327443 ATAGTATTGTAGGCCGGACGAGG - Intronic
1037282856 8:17262770-17262792 ATTATATTGTAGGCCGGACACGG + Intronic
1037305006 8:17496135-17496157 AAATAGTAATAGGCCGGGCATGG + Intergenic
1037811917 8:22091535-22091557 ATATTATTAGTGGCCAGACATGG - Intronic
1038664408 8:29525455-29525477 GTAATGTTTTAGGCCGGGCATGG - Intergenic
1039288357 8:36067250-36067272 CTATTTTTATGGGCCAGACATGG + Intergenic
1039523889 8:38196361-38196383 AAATTATTATAGGCCGGGCGCGG + Intronic
1039593981 8:38774720-38774742 ATATTTTTAAAGGCCAGCCACGG + Intronic
1040676676 8:49758176-49758198 TTTTTGTTAAAGGCCGGTCATGG - Intergenic
1040678155 8:49776100-49776122 ACCTCGTTATAGGCCGGGCACGG - Intergenic
1041687638 8:60658864-60658886 CTATGGTTATAGGCAGCACATGG - Intergenic
1043063706 8:75539326-75539348 ATATTGTTAAAGGCCATATAAGG + Intronic
1044360308 8:91275587-91275609 ATATTCTTTTAGGCCAGGCATGG - Intronic
1044984458 8:97745496-97745518 AAATTTTTGTAGGCCGGGCATGG + Intergenic
1045206496 8:100047103-100047125 ATATTGTTACTGACCAGACACGG - Intronic
1045975687 8:108128377-108128399 ATAATTTTATAGGCCGGGCGTGG + Intergenic
1046183231 8:110679741-110679763 ATATTATTCTAAGCTGGACATGG - Intergenic
1047825549 8:128570394-128570416 ATATTATTATAGGCCAGGGAAGG + Intergenic
1049990276 9:983790-983812 ATATTGCTATAGACAGGACTGGG - Intronic
1050090120 9:2009996-2010018 TGATTGATATAGGCCGGGCACGG + Intergenic
1050557610 9:6803280-6803302 AGATTGTTTTAGGCCAGGCACGG + Intronic
1051863823 9:21655858-21655880 ATACTATTATAGTCCAGACATGG - Intergenic
1054755752 9:68956178-68956200 ACATTCCTATAGGCCGGGCAAGG + Intronic
1055340707 9:75279593-75279615 AAAATTTTATAGGCCGGGCACGG - Intergenic
1055482215 9:76719935-76719957 ATATATTTCTAGGCTGGACATGG - Intronic
1055532579 9:77200194-77200216 ATATTGTTTTAGGCTGGGCATGG + Intronic
1055995709 9:82157199-82157221 TTATTGACAGAGGCCGGACATGG + Intergenic
1057103371 9:92386870-92386892 GTATTTTTTTAGGCCGGGCATGG - Intronic
1057382171 9:94578761-94578783 ATAATTTTATAGGCTGGACGTGG + Intronic
1058036697 9:100260158-100260180 AAAATGTAATAGGTCGGACATGG - Intronic
1058071479 9:100604991-100605013 ATACTGTAATAGGCCAGGCACGG - Intergenic
1061106512 9:128535005-128535027 ATATTATTACAGGCCGGGCGTGG - Intronic
1062330618 9:136042276-136042298 AAATTGTTTTGGGCTGGACAAGG - Intronic
1062493481 9:136820659-136820681 AAATTATTATTGGCCGGGCACGG - Intronic
1203751093 Un_GL000218v1:81176-81198 ATTTTTTTATAGGCTGGGCATGG - Intergenic
1185862689 X:3593766-3593788 AAATTGTTACAGGCCGGGCGCGG - Intergenic
1186447439 X:9643558-9643580 AAATTGATATAGGCCAGGCACGG + Intronic
1188319123 X:28713344-28713366 AAATAGATATAGGCCGGGCATGG - Intronic
1188686802 X:33079300-33079322 ATGGTTTTATAGGCCGGGCATGG - Intronic
1189610641 X:42730549-42730571 AAAGTATTATAGGCCGGGCACGG + Intergenic
1189786634 X:44564756-44564778 ATGTTGTTATAGGCCAGGCATGG + Intergenic
1190792021 X:53709179-53709201 AAATTCTTGGAGGCCGGACATGG - Intergenic
1190849256 X:54222584-54222606 ATAGTATAATAGGCCGGGCATGG + Intronic
1190849697 X:54226549-54226571 ATATAGGAATAGGCCGGGCACGG + Intronic
1190867714 X:54398758-54398780 AAATTGTTTTAGGCCGGGCGAGG - Intergenic
1192481719 X:71491953-71491975 ATGTTGTTAGAGGCCGGGCGCGG - Intronic
1192483826 X:71507857-71507879 AAATAGATATAGGCCGGGCATGG + Intronic
1193322404 X:80138271-80138293 ATTTTGTTTTTGGCCGGGCACGG + Intergenic
1193866566 X:86739162-86739184 ATATTTTAATAGGCTGGGCATGG - Intronic
1195264928 X:103171021-103171043 ATATATTTATAGGCCGAGCATGG - Intergenic
1196735749 X:118979578-118979600 ACATTTATATAGGCTGGACACGG - Intronic
1198026758 X:132714607-132714629 AGAATGTTATTGGCCGGGCACGG - Intronic
1199068088 X:143443939-143443961 ATATAATTATAGGCCGAGCACGG + Intergenic
1199167740 X:144697308-144697330 ATAATGATATAGGCCAGACACGG + Intergenic
1199971153 X:152862869-152862891 ATACTGTGAGAGGCCGGGCACGG + Intronic