ID: 1115618022

View in Genome Browser
Species Human (GRCh38)
Location 14:35114880-35114902
Sequence CTACTTAGGAGGGCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11555
Summary {0: 1, 1: 68, 2: 512, 3: 1557, 4: 9417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115618016_1115618022 -10 Left 1115618016 14:35114867-35114889 CCTATAATCCCAGCTACTTAGGA 0: 250
1: 12716
2: 130747
3: 254343
4: 290879
Right 1115618022 14:35114880-35114902 CTACTTAGGAGGGCTGAGGCAGG 0: 1
1: 68
2: 512
3: 1557
4: 9417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115618022 Original CRISPR CTACTTAGGAGGGCTGAGGC AGG Intronic
Too many off-targets to display for this crispr