ID: 1115618923

View in Genome Browser
Species Human (GRCh38)
Location 14:35121951-35121973
Sequence CGCGGAAGTCGGCCATGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 32}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115618923_1115618929 30 Left 1115618923 14:35121951-35121973 CCAGTCCATGGCCGACTTCCGCG 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1115618929 14:35122004-35122026 TGCTCCACCCCTACCAGCTCAGG 0: 1
1: 0
2: 1
3: 23
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115618923 Original CRISPR CGCGGAAGTCGGCCATGGAC TGG (reversed) Exonic
900095028 1:936716-936738 CGCGGATGGGGGCCATGGATGGG - Intronic
904756567 1:32771522-32771544 GGGGGAAGTCAGCCATGGACAGG - Exonic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
1064086549 10:12349805-12349827 CGCGCTCGTCGGCCATGGCCCGG + Exonic
1071015219 10:80988944-80988966 CGTGGAAGACAGCCATAGACAGG + Intergenic
1076119615 10:127925128-127925150 GGAGGATGTTGGCCATGGACAGG + Intronic
1078734956 11:14011459-14011481 AGGGGGAGTCAGCCATGGACAGG - Intronic
1079268259 11:18956791-18956813 AGAGGAAGTCGGCCATGGACAGG + Intergenic
1088923090 11:114276061-114276083 CGAGGCAGTCGGCCAGGGGCAGG - Intronic
1100540061 12:95548936-95548958 CGCGGAAGGCGGCCACCGGCAGG - Intronic
1113481276 13:110623545-110623567 CGGAGCAGTCGGGCATGGACAGG - Intronic
1115618923 14:35121951-35121973 CGCGGAAGTCGGCCATGGACTGG - Exonic
1124989775 15:34660150-34660172 CCCTGAAGAGGGCCATGGACTGG + Intergenic
1136513123 16:30751336-30751358 GGCGGAAGTGGGCTATGGGCAGG - Intronic
1142227265 16:88883690-88883712 CGTGGAAGTCGGCCACTGCCGGG - Intronic
1142292078 16:89197809-89197831 GGCCGAGGCCGGCCATGGACTGG - Intronic
1151852961 17:76701751-76701773 CGCAGCAGTCGGCCCTGGGCAGG - Intronic
925601461 2:5612343-5612365 CGGGGAAGTCAGCCATCTACAGG + Intergenic
932818793 2:74882137-74882159 CGAGGAAGTCCGCGATGCACTGG - Exonic
948899475 2:240949128-240949150 CCCGAAAGTCAGCCATGGAGGGG + Intronic
1168883330 20:1225836-1225858 CGGGGCAGTGGGCGATGGACGGG - Intergenic
1177894260 21:26842593-26842615 CGTGGAATTCTGCCATCGACTGG + Exonic
1181502212 22:23322731-23322753 CGCCGCAGCCGTCCATGGACTGG - Intergenic
967913425 3:194560295-194560317 CCCGGAAGTCAGCCAGGGTCAGG + Intergenic
968556703 4:1249346-1249368 CGAGGAAGTCGGGCAGGGTCGGG + Intronic
969529043 4:7719710-7719732 CCTGGAAGTCGGCCCCGGACGGG - Intronic
1202765991 4_GL000008v2_random:148934-148956 CGCGGATGTCTCTCATGGACAGG + Intergenic
1002431841 5:179208460-179208482 CGCTGCAGTCGGCCCTGGGCAGG + Intronic
1003222146 6:4170470-4170492 TGTGGATGTCTGCCATGGACAGG - Intergenic
1037580735 8:20244724-20244746 AGCGGAAGTGGGCCAGGCACAGG + Intergenic
1057805355 9:98216006-98216028 CGCTGGAGTTGGCCATGTACCGG + Intronic
1185461880 X:336853-336875 CACGGACGGCGCCCATGGACTGG + Intronic
1189037192 X:37505420-37505442 CGAAGAAGAAGGCCATGGACAGG - Intronic
1199428079 X:147726487-147726509 TGCAAAAGTAGGCCATGGACTGG - Intergenic
1200121671 X:153794057-153794079 GGCCGAAGTTGGCCCTGGACCGG - Exonic